MYD88 (NM_002468) Human Untagged Clone

CAT#: SC118606

MYD88 (untagged)-Human myeloid differentiation primary response gene (88) (MYD88), transcript variant 2

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name MYD88 (NM_002468) Human Untagged Clone
Symbol MYD88
Synonyms MYD88D
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002468 edited
GAATTCGGCACGAGGCGCGCTGAGGCTCCAGGACCGCCCGCCATGGCTGCAGGAGGTCCC
GGCGCGGGGTCTGCGGCCCCGGTCTCCTCCACATCCTCCCTTCCCCTGGCTGCTCTCAAC
ATGCGAGTGCGGCGCCGCCTGTCTCTGTTCTTGAACGTGCGGACACAGGTGGCGGCCGAC
TGGACCGCGCTGGCGGAGGAGATGGACTTTGAGTACTTGGAGATCCGGCAACTGGAGACA
CAAGCGGACCCCACTGGCAGGCTGCTGGACGCCTGGCAGGGACGCCCTGGCGCCTCTGTA
GGCCGACTGCTCGAGCTGCTTACCAAGCTGGGCCGCGACGACGTGCTGCTGGAGCTGGGA
CCCAGCATTGAGGAGGATTGCCAAAAGTATATCTTGAAGCAGCAGCAGGAGGAGGCTGAG
AAGCCTTTACAGGTGGCCGCTGTAGACAGCAGTGTCCCACGGACAGCAGAGCTGGCGGGC
ATCACCACACTTGATGACCCCCTGGGGCATATGCCTGAGCGTTTCGATGCCTTCATCTGC
TATTGCCCCAGCGACATCCAGTTTGTGCAGGAGATGATCCGGCAACTGGAACAGACAAAC
TATCGACTGAAGTTGTGTGTGTCTGACCGCGATGTCCTGCCTGGCACCTGTGTCTGGTCT
ATTGCTAGTGAGCTCATCGAAAAGAGGTGCCGCCGGATGGTGGTGGTTGTCTCTGATGAT
TACCTGCAGAGCAAGGAATGTGACTTCCAGACCAAATTTGCACTCAGCCTCTCTCCAGGT
GCCCATCAGAAGCGACTGATCCCCATCAAGTACAAGGCAATGAAGAAAGAGTTCCCCAGC
ATCCTGAGGTTCATCACTGTCTGCGACTACACCAACCCCTGCACCAAATCTTGGTTCTGG
ACTCGCCTTGCCAAGGCCTTGTCCCTGCCCTGAAGACTGTTCTGAGGCCCTGGGTGTGTG
TGTATCTGTCTGCCTGTCCATGTACTTCTGCCCTGCCTCCTCCTTTCGTTGTAGGAGGAA
TCTGTGCTCTACTTACCTCTCAATTCCTGGAGATGCCAACTTCACAGACACGTCTGCAGC
AGCTGGACATCACATTTCATGTCCTGCATGGAACCAGTGGCTGTGAGTGGCATGTCCACT
TGCTGGATTATCAGCCAGGACACTATAGAACAGGACCAGCTGAGACTAAGAAGGACCAGC
AGAGCCAGCTCAGCTCTGAGCCATTCACACATCTTCACCCTCAGTTTCCTCACTTGAGGA
GTGGGATGGGGAGAACAGAGAGTAGCTGTGTTTGAATCCCTGTAGGAAATGGTGAAGCAT
AGCTCTGGGTCTCCTGGGGGAGACCAGGCTTGGCTGCGGGAGAGCTGGCTGTTGCTGGAC
TACATGCTGGCCACTGCTGTGACCACGACACTGCTGGGGCAGCTTCTTCCACAGTGATGC
CTACTGATGCTTCAGTGCCTCTGCACACCGCCCATTCCACTTCCTCCTTCCCCACAGGGC
AGGTGGGGAAGCAGTTTGGCCCAGCCCAAGGAGACCCCACCTTGAGCCTTATTTCCTAAT
GGGTCCACCTCTCATCTGCATCTTTCACACCTCCCAGCTTCTGCCCAACCTTCAGCAGTG
ACAAGTCCCCAAGAGACTCGCCTGAGCAGCTTGGGCTGCTTTTCATTTCCACCTGTCAGG
ATGCCTGTGGTCATGCTCTCAGCTCCACCTGGCATGAGAAGGGATCCTGGCCTCTGGCAT
ATTCATCAAGTATGAGTTCTGGGGATGAGTCACTGTAATGATGTGAGCAGGGAGCCTTCC
TCCCTGGGCCACCTGCAGAGAGCTTTCCCACCAACTTTGTACCTTGATTGCCTTACAAAG
TTATTTGTTTACAAACAGCGACCATATAAAAGCCTCCTGCCCCAAAGCTTGTGGGCACAT
GGGCACATACAGACTCACATACAGACACACACATATATGTACAGACATGTACTCTCACAC
ACACAGGCACCAGCATACACACGTTTTTCTAGGTACAGCTCCCAGGAACAGCTAGGTGGG
AAAGTCCCATCACTGAGGGAGCCTAACCATGTCCCTGAACAAAAATTGGGCACTCATCTA
TTCCTTTTCTCTTGTGTCCCTACTCATTGAAACCAAACTCTGGAAAGGACCCAATGTACC
AGTATTTATACCTCTAGTGAAGCACAGAGAGAGGAAGAGAGCTGCTTAAACTCACACAAC
AATGAACTGCAGACACAGCTGTTCTCTCCCTCTCTCCTTCCCAGAGCAATTTATACTTTA
CCCTCAGGCTGTCCTCTGGGGAGAAGGTGCCATGGTCTTAGGTGTCTGTGCCCCAGGACA
GACCCTAGGACCCTAAATCCAATAGAAAATGCATATCTTTGCTCCACTTTCAGCCAGGCT
GGAGCAAGGTACCTTTTCTTAGGATCTTGGGAGGGAATGGATGCCCCTCTCTGCATGATC
TTGTTGAGGCATTTAGCTGCCATGCACCTGTCCCCCTTTAATACTGGGCATTTTAAAGCC
ATCTCAAGAGGCATCTTCTACATGTTTTGTACGCATTAAAATAATTTCAAAGATATCTGA
GAAAAGCCGATATTTGCCATTCTTCCTATATCCTGGAATATATCTTGCATCCTGAGTTTA
TAATAATAAATAATATTCTACCTTGGAAAAAAAAAAAAAAAAAAAACTCGAC
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002468 unedited
AATTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCGCGCTGAGGCT
CCAGGACCGCCCGCCATGGCTGCAGGAGGTCCCGGCGCGGGGTCTGCGGCCCCGGTCTCC
TCCACATCCTCCCTTCCCCTGGCTGCTCTCAACATGCGAGTGCGGCGCCGCCTGTCTCTG
TTCTTGAACGTGCGGACACAGGTGGCGGCCGACTGGACCGCGCTGGCGGAGGAGATGGAC
TTTGAGTACTTGGAGATCCGGCAACTGGAGACACAAGCGGACCCCACTGGCAGGCTGCTG
GACGCCTGGCAGGGACGCCCTGGCGCCTCTGTAGGCCGACTGCTCGAGCTGCTTACCAAG
CTGGGCCGCGACGACGTGCTGCTGGAGCTGGGACCCAGCATTGAGGAGGATTGCCAAAAG
TATATCTTGAAGCAGCAGCAGGAGGAGGCTGAGAAGCCTTTACAGGTGGCCGCTGTAGAC
AGCAGTGTCCCACGGACAGCAGAGCTGGCGGGCATCACCACACTTGATGACCCCCTGGGG
CATATGCCTGAGCGTTTCGATGCCTTCATCTGCTATTGCCCCAGCGACATCCAGTTTGTG
CAGGAGATGATCCGGCAACTGGAACAGACAAACTATCGACTGAAGTTGTGTGTGTCTGAC
CGCGATGTCCTGCCTGGCACCTGTGTCTGGTCTATTGCTAGTGAGCTCATCGAAAAGAGT
GCCGCCGGATGGTGGTGGTTGTCTCTGATGATTACCTGCAGAGCAAGGAATGTGACTNCC
AGACCAAATTGCACTCAGCCTCTCTTCAGGTGCCCATCAGAAGCGACTGATCCCCCATCA
GTACCAGGGCATGAAGAAAGAGCTCCCCAGCATCCTCGAGGTCATCACTGTCTGCGACTA
CACCAACCCCTGCACCAAT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_002468 unedited
ATGGCCGCGGCCGCATTCTAGATCGAGTTTTTTTTTTTTTTTTTTTTCCAGGTAGNAAAT
TATTTATTATTATAAACTCAGGATGCAAGATATATTCCAGGATATAGGAAGAATGGCAAA
TATCGGCTTTTCTCAAATATCTTTGAAATTATTTTAATGCGTACAAAACATGTAGAAAAT
GCCTCTTGAGATGGCTTTAAAATGCCCAGTATTAAAGGGGGACAGGTGCATGGCAGCTAA
ATGCCTCAACAAGATCATGCAGAGAGGGGCATCCATTCCCTCCCAAGATCCTAAGAAAAG
GTACCTTGCTCCAGCCTGGCTGAAAGTGGAGCAAAGATATGCATTTTCTATTGGATTTAG
GGTCCTAGGGTCTGTCCTGGGGCACAGACACCTAAGACCATGGCACCTTCTCCCCAGAGG
ACAGCCTGAGGGTAAAGTATAAATTGCTCTGGGAAGGAGAGAGGGAGAGAACAGCTGTGT
CTGCAGTTCATTGTTGTGTGAGTTTAAGCAGCTCTCTTCCTCTCTCTGTGCTTCACTAGA
GGTATAAATACTGGTACATTGGGTCCTTTCCAGAGTTTGGTTTCAATGAGTAGGGACACA
AGAGAAAAGGAATAGATGAGTGCCCAATTTTTGTTCAGGGACATGGTTAGGCTCCCTCAG
TGATGGGACTTTCCCACCTAGCTGTTCCTGGGAGCTGTACCTAGAANAACGTGTGTATGC
TGGTGCCTGTGTGTGTGAGAGTACATGTCTGTACATATATGTNGTGNGTCTGTATGTGAG
TCTGTATGTGCCCATGTGCCCACAAGCTTTTGGGCANGAGGCTTTATATGGTCGCTGTTT
GTAACAAATNACTTTGTAGGGCATCAGGTACAAAAGTTGTGGNNAGCTCTCTGCANGTGG
CCAGGGAGAANGCCTCCTGCTCACATCATACGGGACTCATCCCAGACTATACTGATGATA
TGCAGAGCCAGNATCCTTTCAG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_002468
ORF Size 891 bp
Insert Size 2550
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002468.2, NP_002459
RefSeq Size 2862
Locus ID 4615
Cytogenetics 3p22.2
Domains TIR, death
Protein Families Druggable Genome
Protein Pathways Apoptosis, Toll-like receptor signaling pathway
Gene Summary This gene encodes a cytosolic adapter protein that plays a central role in the innate and adaptive immune response. This protein functions as an essential signal transducer in the interleukin-1 and Toll-like receptor signaling pathways. These pathways regulate that activation of numerous proinflammatory genes. The encoded protein consists of an N-terminal death domain and a C-terminal Toll-interleukin1 receptor domain. Patients with defects in this gene have an increased susceptibility to pyogenic bacterial infections. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.