TIMP2 (NM_003255) Human Untagged Clone

CAT#: SC118083

Reviews ()
Write a review

TIMP2 (untagged)-Human TIMP metallopeptidase inhibitor 2 (TIMP2)



Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product images

Other products for "TIMP2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TIMP2
Synonyms CSC-21K; DDC8
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_003255, the custom clone sequence may differ by one or more nucleotides


ATGGGCGCCGCGGCCCGCACCCTGCGGCTGGCGCTCGGCCTCCTGCTGCTGGCGACGCTGCTTCGCCCGG
CCGACGCCTGCAGCTGCTCCCCGGTGCACCCGCAACAGGCGTTTTGCAATGCAGATGTAGTGATCAGGGC
CAAAGCGGTCAGTGAGAAGGAAGTGGACTCTGGAAACGACATTTATGGCAACCCTATCAAGAGGATCCAG
TATGAGATCAAGCAGATAAAGATGTTCAAAGGGCCTGAGAAGGATATAGAGTTTATCTACACGGCCCCCT
CCTCGGCAGTGTGTGGGGTCTCGCTGGACGTTGGAGGAAAGAAGGAATATCTCATTGCAGGAAAGGCCGA
GGGGGACGGCAAGATGCACATCACCCTCTGTGACTTCATCGTGCCCTGGGACACCCTGAGCACCACCCAG
AAGAAGAGCCTGAACCACAGGTACCAGATGGGCTGCGAGTGCAAGATCACGCGCTGCCCCATGATCCCGT
GCTACATCTCCTCCCCGGACGAGTGCCTCTGGATGGACTGGGTCACAGAGAAGAACATCAACGGGCACCA
GGCCAAGTTCTTCGCCTGCATCAAGAGAAGTGACGGCTCCTGTGCGTGGTACCGCGGCGCGGCGCCCCCC
AAGCAGGAGTTTCTCGACATCGAGGACCCATAA


>OriGene 5' read for NM_003255 unedited
ATAGGGCGGGCCGCGATTCGGCACGAGGGGTAGGAGAGTAAGTTTGCGCGGCCGAGCGGG
GCAGGTGAGGAGGGTGAGCCGCGCGGGAGGGGCCCGCCTCGGCCCCGGCTCAGCCCCCGC
CCGCGCCCCCAGCCCGCCGCCGCGAGCAGCGCCCGGACCCCCCACGGCGGCCCCCGCCCG
CCCAGCCCCCCGGCCCGCCATGGGCGCCGCGGCCCGCACCCTGCGGCTGGCGCTCGGCCT
CCTGCTGCTGGCGACGCTGCTTCGCCCGGCCGACGCCTGCAGCTGCTCCCCGGTGCACCC
GCAACAGGCGTTTTGCAATGCAGATGTAGTGATCAGGGCCAAAGCGGTCAGTGAGAAGGA
AGTGGACTCTGGAAACGACATTTATGGCAACCCTATCAAGAGGATCCAGTATGAGATCAA
GCAGATAAAGATGTTCAAAGGGCCTGAGAAGGATATAGAGTTTATCTACACGGCCCCCTC
CTCGGCAGTGTGTGGGGTCTCACTGGACGTTGGAGGAAAGAAGGAATATCTCATTGCAGG
AAAGGCCGAGGGGGACGGCAAGATGCACATCACCCTCTGTGACTTCATCGTGCCCTGGGA
CACCCTGAGCACCACCCAGAAGAAGAGCCTGAACCACAGGTACCAGATGGGCTGCGAGTG
CAAGATCACGCGCTGCCCCATGATCCCGTGCTACATCTCCTCCCCGGACGAGTGCCTCNT
GGATGGACTGGGGTCACAGAGAGAACATTAACGGGCACCAAGCCAAGTTTCTCGCCTGCA
TAAAGAGAAGTGACGGGCTCTGTGCGTGGTACCGGGGGGCGCGGCCCCCAAGCAGGAGGT
TCTGGACATCGAGACCCATAAGCAGGCCTCCCACGCCCCTGGGGGCAACTGCAAAAAACC
CTCCAGGGTTTCGACTGGNCAGCTCTA
>OriGene 3' read for NM_003255 unedited
AATTCTCATGNCGCGCGGCCCGCAGTTCTAGCGATCNGCCTTTTTTTTTTTTTTTTTTTC
TCTTTGAAATACTGTTTATTGTCCACGGACCGAGCGATTGCTCAAGAATGATACAAAGCA
TCAGAGACATGCGCAGTCTGCTTGACAACTTTCAACAACTCTTGTGTGTTCCCAGCACCG
GAAGGTCTCAAACTTCATATTCCAGCATAAACACAGTGCTCCCCTCCCCCAAAAATCCAA
ACGGAAACAAAATCAACAGAGCTTTAAATTACGGCAGCAAGTCCAATATTTCTTAATACT
TATCAAGCAAAGATTTGAAAATAACTACAATGTAAACTTTATTTTAAATATTTTGAGTTG
CTTGCAGGATGAAAATAGGAGAAGAGAGCTGTGCTTAGAACATAACATATAAATTAAACG
ATGCCAAATGGAGAGCCTTCTTAAACTACATATATATTGCCACTATTTATTGTGAAGGTA
TTTGAGCGGCTTCCTCTGTCAGCTGCCACCCGGCTCTTCTTAACCTGTTTTGTTTTCTGC
TCACCACGGTTAAAAGACCAACGTGTGTGGATCAAATATAAAGGCCACACCTTTCAGACC
GAACCTACTCAAAGATCCTTTACTTTGCAATAATTTGAACTGGAGAACCAAAGACGGGAG
ACGAATGCAAGCAAAGATGCTCAAAGAACCAAAGGAAAGCACCTGAGGAATCCACCTGCA
TAGGCCACGCGTTCCACTCCTGGTCAAATGCTTTCACGATGCAGAAACCCTTTTTTAAAA
AGGGCAAGCCTAATACCTACCAGGGTATTAAAAAACCCGCCCAGGGATGGATACCGCTGA
TGTCAAAACCAAACCAAAACTTTAAAAACCATCCGCCGAAAAAGAGTAAATGGTCCTATT
GTCTCCCCTACAGGACCGAACAGGTGGGGTATGG
Restriction Sites NotI-NotI     
ACCN NM_003255
Insert Size 3630 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_003255.4, NP_003246.1
RefSeq Size 3670 bp
RefSeq ORF 663 bp
Locus ID 7077
UniProt ID P16035
Cytogenetics 17q25.3
Domains NTR
Protein Families Druggable Genome, Secreted Protein
Gene Summary This gene is a member of the TIMP gene family. The proteins encoded by this gene family are natural inhibitors of the matrix metalloproteinases, a group of peptidases involved in degradation of the extracellular matrix. In addition to an inhibitory role against metalloproteinases, the encoded protein has a unique role among TIMP family members in its ability to directly suppress the proliferation of endothelial cells. As a result, the encoded protein may be critical to the maintenance of tissue homeostasis by suppressing the proliferation of quiescent tissues in response to angiogenic factors, and by inhibiting protease activity in tissues undergoing remodelling of the extracellular matrix. [provided by RefSeq, Jul 2008]
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.