UBE2L3 (NM_003347) Human Untagged Clone

CAT#: SC118049

UBE2L3 (untagged)-Human ubiquitin-conjugating enzyme E2L 3 (UBE2L3), transcript variant 1

USD 402


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name UBE2L3 (NM_003347) Human Untagged Clone
Symbol UBE2L3
Synonyms E2-F1; L-UBC; UBCH7; UbcM4
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_003347 edited
ATGGCGGCCAGCAGGAGGCTGATGAAGGAGCTTGAAGAAATCCGCAAATGTGGGATGAAA
AACTTCCGTAACATCCAGGTTGATGAAGCTAATTTATTGACTTGGCAAGGGCTTATTGTT
CCTGACAACCCTCCATATGATAAGGGAGCCTTCAGAATCGAAATCAACTTTCCAGCAGAG
TACCCATTCAAACCACCGAAGATCACATTTAAAACAAAGATCTATCACCCAAACATCGAC
GAAAAGGGGCAGGTCTGTCTGCCAGTAATTAGTGCCGAAAACTGGAAGCCAGCAACCAAA
ACCGACCAAGTAATCCAGTCCCTCATAGCACTGGTGAATGACCCCCAGCCTGAGCACCCG
CTTCGGGCTGACCTAGCTGAAGAATACTCTAAGGACCGTAAAAAATTCTGTAAGAATGCT
GAAGAGTTTACAAAGAAATATGGGGAAAAGCGACCTGTGGACTAAAATCTGCCACGATTG
GTTCCAGCAAGTGTGAGCAGAGACCCCGTGCAGTGCATTCAGACACCCCGCAAAGCAGGA
CTCTGTGGAAATTGACACGTGCCACCGCCTGGCGTTCGCTTGTGGCAGTTACTAACTTTC
TACAGTTTTCTTAATCAAAAGTGGTCTAGGTAACCTGTAAAGAAAGGATTAAAAATTTAA
GATGTTCTAGTTCTGCTCTCTTTGTTTTAAAAATCACTGCTTCAATCTACTTCAAAAGAA
TGGTGTTTCTTTTCTTGTCCAATTTTATCCAAAATCTTCAAGTTACATTTAACCCATAAG
GTTTAAAAAAAAAAAAAAAAAACTCGA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_003347 unedited
TTTTCACCATTTTGTCATACGATTTACTATAGGCGGCCGCGAAATTCGCACGAGGCCAAG
ATGGCGGCCAGCAGGAGGCTGATGAAGGAGCTTGAAGAAACCGCAAAGTGGGATGAAAAA
CTTCCGTAACATCCAGGTTGATGAAGCTAATTTATTGACTTGGCAAGGGCTTATTGTTCC
TGACAACCCTCCATATGATAAGGGAGCCTTCAGAATCGAAATCAACTTTCCAGCAGAGTA
CCCATTCAAACCACCGAAGATCACATTTAAAACAAAGATCTATCACCCAAACATCGACGA
AAAGGGGCAGGTCTGTCTGCCAGTAATTAGTGCCGAAAACTGGAAGCCAGCAACCAAAAC
CGACCAAGTAATCCAGTCCCTCATAGCACTGGTGAATGACCCCCAGCCTGAGCACCCGCT
TCGGGCTGACCTAGCTGAAGAATACTCTAAGGACCGTAAAAAATTCTGTAAGAATGCTGA
AGAGTTTACAAAGAAATATGGGGAAAAGCGACCTGTGGACTAAAATCTGCCACGATTGGT
TCCAGCAAGTGTGAGCAGAGACCCCGTGCAGTGCATTCAGACACCCCGCANAGCATGACT
CTGTGGAAATTGACACGTGCCACCGCCTGGCGTTCGCTTTGTGGCAGTTACTAACTTTCT
ACAGTTTTCTTAATCAAAAGTGGTCTATGTAACCTGTAAAGAAAGGATTAAAAATTAAAG
ATGTTCTAGTTTCTGCTCTCTTTGTTTTAAAATCACTGCTCCAATCTACTTCAAAAGATG
GTGTTTCTTTTTTTTGTCCAATTTATCCAAAATCTTTAAGTTACATTTTAACCCATAAAG
GTTTAAAAAAATAAAAAAAAAAACTCGCACTTTTAAATTGCGGCCCGGGGTCATATACTG
GTTTCCTTGAAAGAATCTCCGGTGGTCTATTTCTGNGAACCCCTTCCCCG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_003347 unedited
CCGCAATCTAAAGTCGAGTTTTTTTTTTTTTTTTTTAAACCTTATGGGTTAAATGTAACT
TGAAGATTTTGGATAAAATTGGACAAGAAAAGAAACACCATTCTTTTGAAGTAGATTGAA
GCAGTGATTTTTAAAACAAAGAGAGCAGAACTAGAACATCTTAAATTTTTAATCCTTTCT
TTACAGGTTACCTAGACCACTTTTGATTAAGAAAACTGTAGAAAGTTAGTAACTGCCACA
AGCGAACGCCAGGCGGTGGCACGTGTCAATTTCCACAGAGTCCTGCTTTGCGGGGTGTCT
GAATGCACTGCACGGGGTCTCTGCTCACACTTGCTGGAACCAATCGTGGCAGATTTTAGT
CCACAGGTCGCTTTTCCCCATATTTCTTTGTAAACTCTTCAGCATTCTTACAGAATTTTT
TACGGTCCTTAGAGTATTCTTCAGCTAGGTCAGCCCGAAGCGGGTGCTCAGGCTGGGGGT
CATTCACCAGTGCTATGAGGGACTGGATTACTTGGTCGGTTTTGGTTGCTGGCTTCCAGT
TTTCGGCACTAATTACTGGCAGACAGACCTGCCCCTTTTCGTCGATGTTTGAGTGATAGA
TCTTTGTTCTAATGTGATCTTCGGAGGTTTGAATGGGTACTCTGCTGAAAAGTGATTTCG
ATTCTGAAGGCTCCCTTANATATGGAGGCNTGCAGGAACAATAGCCCCTGCCAGTCATAA
ATTAGCTCATCAACCTGGAGTTACGGAAGTTTTTATCCACATTTGCGGATTTTTAAGCTC
CTTATAGCCTCCTGTGCCCGCTCTGGGCTTTGCCGATTCGCGGCGGCTTTGGAGGCGATT
ACAAATCTGAGGTTACTAACCAGCTTGCTTTTTGGACTCCACCGACCGCCTAACGGCATT
GGTAACGGGGCGGGGATTACAATTTTGGAAGCCGCGTGTTTGGGCCAACAAATCCTTGCG
G
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_003347
ORF Size 465 bp
Insert Size 820
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_003347.2, NP_003338
RefSeq Size 2907
RefSeq ORF 465
Locus ID 7332
Cytogenetics 22q11.21
Protein Pathways Ubiquitin mediated proteolysis, Parkinson's disease
Gene Summary The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes (E1s), ubiquitin-conjugating enzymes (E2s) and ubiquitin-protein ligases (E3s). This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is demonstrated to participate in the ubiquitination of p53, c-Fos, and the NF-kB precursor p105 in vitro. Several alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2009].
Transcript Variant: This variant (1) uses an alternate 5' splice site and downstream translational start site, compared to variant 4. It encodes a shorter and distinct N-terminus in isoform 1, compared to isoform 4.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations