NDUFB10 (NM_004548) Human Untagged Clone

CAT#: SC117269

Reviews ()
Write a review

NDUFB10 (untagged)-Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa (NDUFB10), nuclear gene encoding mitochondrial protein



  "NM_004548" in other vectors (4)

Reconstitution Protocol

USD 429.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NDUFB10
Synonyms PDSW
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC117269 sequence for NM_004548 edited (data generated by NextGen Sequencing)
ATGCCGGACAGCTGGGACAAGGATGTGTACCCTGAGCCCCCGCGCCGCACGCCGGTGCAG
CCCAATCCCATCGTCTACATGATGAAAGCGTTCGACCTCATCGTGGACCGACCCGTGACC
CTCGTGAGAGAATTTATAGAGCGGCAGCACGCAAAGAACAGGTATTACTACTACCACCGG
CAGTACCGCCGCGTGCCAGACATCACTGAGTGCAAGGAGGAGGACATCATGTGCATGTAT
GAAGCCGAAATGCAGTGGAAGAGGGACTACAAAGTCGACCAAGAAATTATCAACATTATG
CAGGATCGGCTCAAAGCCTGTCAGCAGAGGGAAGGACAGAACTACCAGCAGAACTGTATC
AAGGAAGTGGAGCAGTTCACCCAGGTGGCCAAGGCCTACCAGGACCGCTATCAGGACCTG
GGGGCCTACAGTTCTGCCAGGAAGTGCCTGGCCAAACAGAGGCAGAGGATGCTGCAAGAG
AGAAAAGCTGCAAAAGAGGCCGCCGCTGCCACCTCCTGA

Clone variation with respect to NM_004548.2
>OriGene 5' read for NM_004548 unedited
GCACGAGGCGCGGGACCCGGACGTAGGTAGAGGCCAGGGCAACGCGTCCGGGAGCGGAGT
CCGCGCCCGCCGCCGCCATGCCGGACAGCTGGGACAAGGATGTGTACCCTGAGCCCCCGC
GCCGCACGCCGGTGCAGCCCAATCCCATCGTCTACATGATGAAAGCGTTCGACCTCATCG
TGGACCGACCCGTGACCCTCGTGAGAGAATTTATAGAGCGGCAGCACGCAAAGAACAGGT
ATTACTACTACCACCGGCAGTACCGCCGCGTGCCAGACATCACTGAGTGCAAGGAGGAGG
ACATCATGTGCATGTATGAAGCCGAAATGCAGTGGAAGAGGGACTACAAAGTCGACCAAG
AAATTATCAACATTATGCAGGATCGGCTCAAAGCCTGTCAGCAGAGGGAAGGACAGAACT
ACCAGCAGAACTGTATCAAGGAAGTGGAGCAGTTCACCCAGGT
>OriGene 3' read for NM_004548 unedited
CGCAATCTAAAGTCGAGTTTTTTTTTTTTTTTTTTCAGGTTGCAGGGCTTTATATTTCAG
CAACAGTCATACAGAGCCACACAGCAAGGGCACCCACAGCTGCCTCAGGAGGTGGCAGCG
GCGGCCCTTTTTGCAGCTTTTCTCTCTTGCAGCATCCTCTGCCTCTGTTTGGCCAGGCAC
TTCCTGGCAGAACTGTAGGCCCCCAGGTCCTGATACCGGTCCTGGTAGGCCTTGGCCACC
TGGGTGAACTGCTCCACTTCCTTGATACACCTCTGCTGGTAGTTCTGTCCTTCCCTCTGC
TGACAGGCTTTGAGCCGATCCTGCATAATGTTGATAATTTCTTGCNCGACTTTGTAGTCC
CTCTTCCACTGCATTTCGGCTTCATACATGCACATGATGTCCTCCTCCTTGCACTCAGTG
ATGTCTGGCACGCGGCGGTACTGCCGGTGGTAGTAGTAATACCTGTTCTTTGCGTGCTGC
CGCTCTATAAATTCTCTCACGAGGGTCACGGGTCGGTCCACGATGAGGTCGAACGCTTTC
ATCATGTAGACGATGGGATTGGGCTGCACCGGCGTGCGGCGCGGGGGCTCAGGGTACACA
TCCTTGTCCCATCTGTCCGGCATGGCGGCGGCGGGCGCGGACTCCGCTCCCGGACGCGTT
GCCCTGGCCTCTACCTACGTCCGGGTCCCGCGCCTCGTGCCGAATTCGCGGCCGCCCTAT
ATGGAGTCGCATAACAAATTCTGACGGTTACCAAACCAGCTCTGCCTATTAGACCTCCCA
CCGACACCCTCCCGCCCATTGCGTAACGGGGCCGGGTTATTACCACATTTTGGAAAGCCC
GTTGATTTTGTTGCCAAACAACCCCATTGCCGCAATGGGCGGAGACTGGAAACCCCCGGG
GTCAACCGCTTTCCCCCCATGGGGACCTCCAAACCCCTTCCTGGAAAACGCGACTAACCC
TATATTCGCCCTCTGAAACCCCTACGTCT
Restriction Sites NotI-NotI     
ACCN NM_004548
Insert Size 720 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004548.1, NP_004539.1
RefSeq Size 736 bp
RefSeq ORF 519 bp
Locus ID 4716
UniProt ID O96000
Cytogenetics 16p13.3
Protein Pathways Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
Gene Summary Accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I), that is believed not to be involved in catalysis. Complex I functions in the transfer of electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone.[UniProtKB/Swiss-Prot Function]

Other Versions

Other products for "NDUFB10"
Frequently bought together (4)
NDUFB10 mouse monoclonal antibody, clone OTI1H6 (formerly 1H6)
    • 100 ul

USD 417.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 473.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 149.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 55.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.