WNT7A (NM_004625) Human Untagged Clone

CAT#: SC117232

Reviews ()
Write a review

WNT7A (untagged)-Human wingless-type MMTV integration site family, member 7A (WNT7A)



  "NM_004625" in other vectors (6)

USD 310.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name WNT7A (NM_004625) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol WNT7A
Synonyms Wnt-7a
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>OriGene sequence for NM_004625 edited
GAATTCGGCACCAGCGCGGACGGGCGCACCGACAGACGGCCCCGGGGACGCCTCGGCTCG
CGCCTCCCGGGCGGGCTATGTTGATTGCCCCGCCGGGGCCGGCCCGCGGGATCAGCACAG
CCCGGCCCGCGGCCCCGGCGGCCAATCGGGACTATGAACCGGAAAGCGCGGCGCTGCCTG
GGCCACCTCTTTCTCAGCCTGGGCATGGTCTACCTCCGGATCGGTGGCTTCTCCTCAGTG
GTAGCTCTGGGCGCAAGCATCATCTGTAACAAGATCCCAGGCCTGGCTCCCAGACAGCGG
GCGATCTGCCAGAGCCGGCCCGACGCCATCATCGTCATAGGAGAAGGCTCACAAATGGGC
CTGGACGAGTGTCAGTTTCAGTTCCGCAATGGCCGCTGGAACTGCTCTGCACTGGGAGAG
CGCACCGTCTTCGGGAAGGAGCTCAAAGTGGGGAGCCGGGAGGCTGCGTTCACCTACGCC
ATCATTGCCGCCGGCGTGGCCCACGCCATCACAGCTGCCTGTACCCAGGGCAACCTGAGC
GACTGTGGCTGCGACAAAGAGAAGCAAGGCCAGTACCACCGGGACGAGGGCTGGAAGTGG
GGTGGCTGCTCTGCCGACATCCGCTACGGCATCGGCTTCGCCAAGGTCTTTGTGGATGCC
CGGGAGATCAAGCAGAATGCCCGGACTCTCATGAACTTGCACAACAACGAGGCAGGCCGA
AAGATCCTGGAGGAGAACATGAAGCTGGAATGTAAGTGCCACGGCGTGTCAGGCTCGTGC
ACCACCAAGACGTGCTGGACCACACTGCCACAGTTTCGGGAGCTGGGCTACGTGCTCAAG
GACAAGTACAACGAGGCCGTTCACGTGGAGCCTGTGCGTGCCAGCCGCAACAAGCGGCCC
ACCTTCCTGAAGATCAAGAAGCCACTGTCGTACCGCAAGCCCATGGACACGGACCTGGTG
TACATCGAGAAGTCGCCCAACTACTGCGAGGAGGACCCGGTGACCGGCAGTGTGGGCACC
CAGGGCCGCGCCTGCAACAAGACGGCTCCCCAGGCCAGCGGCTGTGACCTCATGTGCTGT
GGGCGTGGCTACAACACCCACCAGTACGCCCGCGTGTGGCAGTGCAACTGTAAGTTCCAC
TGGTGCTGCTATGTCAAGTGCAACACGTGCAGCGAGCGCACGGAGATGTACACGTGCAAG
TGAGCCCCGTGTGCACACCACCCTCCCGCTGCAAGTCAGATTGCTGGGAGGACTGGACCG
TTTCCAAGCTGCGGGCTCCCTGGCAGGATGCTGAGCTTGTCTTTTCTGCTGAGGAGGGTA
CTTTTCCTGGGTTTCCTGCAGGCATCCGTGGGGGAAAAAAAATCTCTCAGAGCCCTCAAC
TATTCTGTTCCACACCCAATGCTGCTCCACCCTCCCCCAGACACAGCCCAGGTCCCTCCG
CGGCTGGAGCGAAGCCTTCTGCAGCAGGAACTCTGGACCCCTGGGCCTCATCACAGCAAT
ATTTAACAATTTATTCTGATAAAAATAATATTAATTTATTTAATTAAAAAGAATTCTTCC
ACCTCAAAAAAAAAAAAAAAAAACTCGAC
>OriGene 5' read for NM_004625 unedited
GGCGCGAATTTGAAACACGATTTACTATAGGGCGGCCGCGCAATTCGCACCAGCGCGGAC
GGTCGCACCGACAGACGGCCCCGGGGACGCCTCGGCTCGCGCCTCCCGGGCGGGCTATGT
TGATTGCCCCGCCGGGGCCGGCCCGCGGGATCAGCACAGCCCGGCCCGCGGCCCCGGCGG
CCAATCGGGACTATGAACCGGAAAGCGCGGCGCTGTCTGGGCCACCTCTTTCTCAGCCTG
GGCATGGTCTACCTCCGGATCGGTGGCTTCTCCTCAGTGGTAGCTCTGGGCGCAAGCATC
ATCTGTAACAAGATCCCAGGCCTGGCTCCCAGACAGCGGGCGATCTGCCAGAGCCGGCCC
GACGCCATCATCGTCATAGGAGAAGGCTCACAAATGGGCCTGGACGAGTGTCAGTTTCAG
TTCCGCAATGGCCGCTGGAACTGCTCTGCACTGGGAGAGCGCACCGTCTTCGGGAAGGAG
CTCAAAGTGGGGAGCCGGGAGGCTGCGTTCACCTACGCCATCATTGCCGCCGGCGTGGCC
CACGCCATCACAGCTGCCTGTACCCAGGGCAACCTGAGCGACTGTGGCTGCGACAAAGAG
AAGCAAGGCCAGTACCACCGGGACGAGGGCTGGAAGTGGGGTGGCTGCTCTGCCGACATC
CGCTACGGCATCGGCTTCGCCAAGGTCTTTGTGGATGCCCGGGAGATCAAGCAGAATGCC
CGGACTCTCATGAACTTGCACAACAACGATGCAGGCCGAAAGATCCTGGAGGAGAACATG
AAGCTGCAATGTAGTGCCACGGTGTGTCAGGCTCCTGCACCCCCAGACGTGCTGTACCAC
CTGCCACAGTTCCTGCAGCTGGGCTACGTGCCCAAGACAAGTACAACGAGCCGCTCACTT
GGACCTGTGCGGCCACCCGCAACAACGGCCAACCTTCTGTAGACCAGAAGCACTGCCGTA
CCGCAGTCCATGCN
>OriGene 3' read for NM_004625 unedited
TCCATTAGGGCATTGGCTGATGGCAACTTCCCAGGNCACAGGGAAAGGCACTGGAGGCAG
GGGCTCACAGGGCATGCCACCCGGGTATCTGTTCAGAACAGCTATGACCGCGGCCGCAAT
CTAGAGTCGAGTTTTTTTTTTTTTTTTTTGAGGTGGAAGAATTCTTTTTAATTAAATAAA
TTAATATTATTTTTATCAGAATAAATTGTTAAATATTGCTGAGAAGAGGCCCAGGGGTCC
AGAGTTCCTGCTGCAGAAGGCTTCGCTCCAGCCGCGGAGGGACCTGGGCTGTGTCTGGGG
GAGGGTGGAGCACCATTGGGTGTGGAACAGAATAGTTGAGGGCTCTGAGAGATTTTTTTT
CCCCCACGGATGCCTGCAGGAAACCCAGGAAAAGTACCCTCCTCAACAAAAAAGACAAGC
TCAGCATCCTGCCAGGGAGCCCGCAGCTTGGAAACGGTCCAGTCCTCCCAGCAATCTGAC
TTGCAGCGGGAGGGTGGTGTGCACACGGGGCTCACTTGCACGTGTACATCTCCGTGCGCT
CGCTGCACGTGTTGCACTTGACATAGCACCACCAGTGGAACTTACAGTTGCACTGCCACA
CACGGGCGTACTGGTGGGTGTTGTAGCCACGCCCACAGCACATGAGGTCACAGCCGCTGG
CCTGGGGAGCCGTCTTGTTGCAGGCGCGGCCCTGGGTGCCCACACTGCCCGTCACCGGGT
CCTCCTCGCAATATTTGGGCGACTTCTCGATGTACACCAAGTCCGTGTCCATGGGCTTGC
GGTACGACAGTGGCTTCTTGGATCTTAAAGAAAGCGGGCCCCCTGTTGCCGCCCGGCCCG
CCCCAGGCTTCACGTGAAAGGCCCCCGTTGCACTTGTCCCTGAACCACA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_004625
Insert Size 1700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004625.3, NP_004616.2
RefSeq Size 1732 bp
RefSeq ORF 1050 bp
Locus ID 7476
Cytogenetics 3p25.1
Domains wnt
Protein Families Druggable Genome, Secreted Protein, Transmembrane
Protein Pathways Basal cell carcinoma, Hedgehog signaling pathway, Melanogenesis, Pathways in cancer, Wnt signaling pathway
Gene Summary This gene is a member of the WNT gene family, which consists of structurally related genes that encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is involved in the development of the anterior-posterior axis in the female reproductive tract, and also plays a critical role in uterine smooth muscle pattering and maintenance of adult uterine function. Mutations in this gene are associated with Fuhrmann and Al-Awadi/Raas-Rothschild/Schinzel phocomelia syndromes. [provided by RefSeq, Jul 2008]

Citations (1)

Other Versions

Other products for "WNT7A"
Frequently bought together (2)
WNT7A Rabbit Polyclonal (Internal) Antibody
    • 50 ug

USD 425.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools