ABCG1 (NM_004915) Human Untagged Clone

CAT#: SC117061

ABCG1 (untagged)-Human ATP-binding cassette, sub-family G (WHITE), member 1 (ABCG1), transcript variant 4

USD 1,298


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name ABCG1 (NM_004915) Human Untagged Clone
Symbol ABCG1
Synonyms ABC8; WHITE1
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_004915, the custom clone sequence may differ by one or more nucleotides


ATGGCCTGTCTGATGGCCGCTTTCTCGGTCGGCACCGCCATGAATGCCAGCAGTTACTCTGCAGAGATGA
CGGAGCCCAAGTCGGTGTGTGTCTCGGTGGATGAGGTGGTGTCCAGCAACATGGAGGCCACTGAGACGGA
CCTGCTGAATGGACATCTGAAAAAAGTAGATAATAACCTCACGGAAGCCCAGCGCTTCTCCTCCTTGCCT
CGGAGGGCAGCTGTGAACATTGAATTCAGGGACCTTTCCTATTCGGTTCCTGAAGGACCCTGGTGGAGGA
AGAAAGGATACAAGACCCTCCTGAAAGGAATTTCCGGGAAGTTCAATAGTGGTGAGTTGGTGGCCATTAT
GGGTCCTTCCGGGGCCGGGAAGTCCACGCTGATGAACATCCTGGCTGGATACAGGGAGACGGGCATGAAG
GGGGCCGTCCTCATCAACGGCCTGCCCCGGGACCTGCGCTGCTTCCGGAAGGTGTCCTGCTACATCATGC
AGGATGACATGCTGCTGCCGCATCTCACTGTGCAGGAGGCCATGATGGTGTCGGCACATCTGAAGCTTCA
GGAGAAGGATGAAGGCAGAAGGGAAATGGTCAAGGAGATACTGACAGCGCTGGGCTTGCTGTCTTGCGCC
AACACGCGGACCGGGAGCCTGTCAGGTGGTCAGCGCAAGCGCCTGGCCATCGCGCTGGAGCTGGTGAACA
ACCCTCCAGTCATGTTCTTCGATGAGCCCACCAGCGGCCTGGACAGCGCCTCCTGCTTCCAGGTGGTCTC
GCTGATGAAAGGGCTCGCTCAAGGGGGTCGCTCCATCATTTGCACCATCCACCAGCCCAGCGCCAAACTC
TTCGAGCTGTTCGACCAGCTTTACGTCCTGAGTCAAGGACAATGTGTGTACCGGGGAAAAGTCTGCAATC
TTGTGCCATATTTGAGGGATTTGGGTCTGAACTGCCCAACCTACCACAACCCAGCAGATTTTGTCATGGA
GGTTGCATCCGGCGAGTACGGTGATCAGAACAGTCGGCTGGTGAGAGCGGTTCGGGAGGGCATGTGTGAC
TCAGACCACAAGAGAGACCTCGGGGGTGATGCCGAGGTGAACCCTTTTCTTTGGCACCGGCCCTCTGAAG
AGGTAAAGCAGACAAAACGATTAAAGGGGTTGAGAAAGGACTCCTCGTCCATGGAAGGCTGCCACAGCTT
CTCTGCCAGCTGCCTCACGCAGTTCTGCATCCTCTTCAAGAGGACCTTCCTCAGCATCATGAGGGACTCG
GTCCTGACACACCTGCGCATCACCTCGCACATTGGGATCGGCCTCCTCATTGGCCTGCTGTACTTGGGGA
TCGGGAACGAAGCCAAGAAGGTCTTGAGCAACTCCGGCTTCCTCTTCTTCTCCATGCTGTTCCTCATGTT
CGCGGCCCTCATGCCTACTGTTCTGACATTTCCCCTGGAGATGGGAGTCTTTCTTCGGGAACACCTGAAC
TACTGGTACAGCCTGAAGGCCTACTACCTGGCCAAGACCATGGCAGACGTGCCCTTTCAGATCATGTTCC
CAGTGGCCTACTGCAGCATCGTGTACTGGATGACGTCGCAGCCGTCCGACGCCGTGCGCTTTGTGCTGTT
TGCCGCGCTGGGCACCATGACCTCCCTGGTGGCACAGTCCCTGGGCCTGCTGATCGGAGCCGCCTCCACG
TCCCTGCAGGTGGCCACTTTCGTGGGCCCAGTGACAGCCATCCCGGTGCTCCTGTTCTCGGGGTTCTTCG
TCAGCTTCGACACCATCCCCACGTACCTACAGTGGATGTCCTACATCTCCTATGTCAGGTATGGGTTCGA
AGGGGTCATCCTCTCCATCTATGGCTTAGACCGGGAAGATCTGCACTGTGACATCGACGAGACGTGCCAC
TTCCAGAAGTCGGAGGCCATCCTGCGGGAGCTGGACGTGGAAAATGCCAAGCTGTACCTGGACTTCATCG
TACTCGGGATTTTCTTCATCTCCCTCCGCCTCATTGCCTATTTTGTCCTCAGGTACAAAATCCGGGCAGA
GAGGTAA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_004915 unedited
NCGGTTTCGATTTGTATACGACTCATATAGGGCGGCCGCGAATTCGCACGAGGGCAGCCC
GCACCCCGCGCAGCGGCTGAGCCGGGAGCCAGCGCAGCCTCGGCCCCGCAGCTCAAGCCT
CGTCCCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCCCCGGGGCATGGCCTGTCTGATG
GCCGCTTTCTCGGTCGGCACCGCCATGAATGCCAGCAGTTACTCTGCAGAGATGACGGAG
CCCAAGTCGGTGTGTGTCTCGGTGGATGAGGTGGTGTCCAGCAACATGGAGGCCACTGAG
ACGGACCTGCTGAATGGACATCTGAAAAAAGTAGATAATAACCTCACGGAAGCCCAGCGC
TTCTCCTCCTTGCCTCGGAGGGCAGCTGTGAACATTGAATTCAGGGACCTTTCCTATTCG
GTTCCTGAAGGACCCTGGTGGAGGAAGAAAGGATACAAGACCCTCCTGAAAGGAATTTCC
GGGAAGTTCAATAGTGGTGAGTTGGTGGCCATTATGGGTCCTTCCGGGGCCGGGAAGTCC
ACGCTGATGAACATCCTGGCTGGATACAGGGAGACGGGCATGAAGGGGGCCGTCCTCATC
AACGGCCTGCCCCGGGACCTGCGCTGCTTCCGNGAGGTGTCCTGCTACATCATGCANGAT
GACATGCTGCTGCCGCATCTCACTGTGCAGGAGGCCATGATGGTGTCGGCACATCTGAAG
CTTCAGGAGAAGGATGAAGGCAGAAGGGAAATGGTCAAGGAGATACTGACAGCGCTGGGC
TTGCTGTCTTGCGCCACACGCGGACCGNGAGCCTGTCAGGTGGTCAGCGCAAGCGCCTGG
CCATCGCGCTGGAGCTGGGTGACNACCCTNNCAGTCATGTCTNCGATGAGCCCNACCAGC
GCCTGGACAGCGCTT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_004915 unedited
AAAACATCTCATTTACGCTTGAAAATAAGTAGTCACGTGGGAAAAGTAAGACTTTGAAAG
AGTTGGCCAATGTCTTCTCACAATTTTTTGTATAGCTTTTAAAAATGTCTGCATGGCTCA
TTGGAGATGGTGTCCACGTCTTCCCTCCACCTGGAACCTGCATTCAATCCTTCACAAGTG
CTGTCTATGTATGAGACCAGCTGGGTGACTCGGTTAAACCCCTCGCCTCTCTAAACAAAG
TATGTGATTTACCCTGAATCATTCTTCAGCAAGTACTAAAAAGGTATAATTTCTTAAAAT
GAATGCGATTGATCGACTTTTGGCTTGCAAAAATGACTTCTCATTGGAAAAGAGACACAC
CTTAGAAAGATGAAAATGTGAAAAACAACAGTCATAAAATGGAATCGCTCCATGCTCGGA
CTCTCTGCCACCAGACATCTGACTGTGCAGCCATCAGCTGAGAGGCTGCTTGCAGTTCCC
CATCCAGGACCCACGGTGCCTGGTGCTAAGGACCGACTGGACTGAGGAAGCCTCTCATCA
CCAGCTGTGTCGCAGCTTTAAATTCTGCCCCAGTTGTGGCATTTAAAATCCTGATCGTAA
AAAAAAAAAAAAAACACCCATCTGCCCACCTCTTCCTAGCTAAAGCTAGAAAGGGGAATG
GGAGAGAATACCCACCCCACCTTGGCCTAGTGGCTGAGCTCGATAAACCCCCAAACCCCA
ACGCGGTTCCAAGGGGTTGGGTTCAAAAAATTTCCTGGTCGCCCCGTCGGGGACAAGGCT
TGCCCTCCCCCATTCTCAGTCCGCGCCCCTCGTCCTCCATGTTCCTATCCTTCTTGTTTC
CTGGGCCTACACGGCGTTTTCCCCTTCCTCTCGTTCTTATGTTCCCACGCATTAATTCTC
CCCCTTCCTCTACGCGTCCTCAAACAATTTCCACTCCGCGTATTACTTCTCTGTCATCTC
CGGCTGTNTCCTCGCGCATCCCGCTTGTGTTCTCTTCCTCTCTCCACGTTGTTGCCTTTG
TCGCCTCGCCTCTCGTATTCT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_004915
ORF Size 2037 bp
Insert Size 3270
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_004915.3, NP_004906
RefSeq Size 3018
RefSeq ORF 2037
Locus ID 9619
Cytogenetics 21q22.3
Domains ABC_tran, AAA
Protein Families Transmembrane, Druggable Genome
Protein Pathways ABC transporters
Gene Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. It is involved in macrophage cholesterol and phospholipids transport, and may regulate cellular lipid homeostasis in other cell types. Six alternative splice variants have been identified. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (4) differs in the 5' end-region compared to variant 1, which includes a part of the coding region. The resulting isoform (4) has a distinct and shorter N-terminus, as compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.