HDAC1 (NM_004964) Human Untagged Clone

CAT#: SC117054

HDAC1 (untagged)-Human histone deacetylase 1 (HDAC1)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name HDAC1 (NM_004964) Human Untagged Clone
Symbol HDAC1
Synonyms GON-10; HD1; RPD3; RPD3L1
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_004964 edited
ATGGCGCAGACGCAGGGCACCCGGAGGAAAGTCTGTTACTACTACGACGGGGATGTTGGA
AATTACTATTATGGACAAGGCCACCCAATGAAGCCTCACCGAATCCGCATGACTCATAAT
TTGCTGCTCAACTATGGTCTCTACCGAAAAATGGAAATCTATCGCCCTCACAAAGCCAAT
GCTGAGGAGATGACCAAGTACCACAGCGATGACTACATTAAATTCTTGCGCTCCATCCGT
CCAGATAACATGTCGGAGTACAGCAAGCAGATGCAGAGATTCAACGTTGGTGAGGACTGT
CCAGTATTCGATGGCCTGTTTGAGTTCTGTCAGTTGTCTACTGGTGGTTCTGTGGCAAGT
GCTGTGAAACTTAATAAGCAGCAGACGGACATCGCTGTGAATTGGGCTGGGGGCCTGCAC
CATGCAAAGAAGTCCGAGGCATCTGGCTTCTGTTACGTCAATGATATCGTCTTGGCCATC
CTGGAACTGCTAAAGTATCACCAGAGGGTGCTGTACATTGACATTGATATTCACCATGGT
GACGGCGTGGAAGAGGCCTTCTACACCACGGACCGGGTCATGACTGTGTCCTTTCATAAG
TATGGAGAGTACTTCCCAGGAACTGGGGACCTACGGGATATCGGGGCTGGCAAAGGCAAG
TATTATGCTGTTAACTACCCGCTCCGAGACGGGATTGATGACGAGTCCTATGAGGCCATT
TTCAAGCCGGTCATGTCCAAAGTAATGGAGATGTTCCAGCCTAGTGCGGTGGTCTTACAG
TGTGGCTCAGACTCCCTATCTGGGGATCGGTTAGGTTGCTTCAATCTAACTATCAAAGGA
CACGCCAAGTGTGTGGAATTTGTCAAGAGCTTTAACCTGCCTATGCTGATGCTGGGAGGC
GGTGGTTACACCATTCGTAACGTTGCCCGGTGCTGGACATATGAGACAGCTGTGGCCCTG
GATACGGAGATCCCTAATGAGCTTCCATACAATGACTACTTTGAATACTTTGGACCAGAT
TTCAAGCTCCACATCAGTCCTTCCAATATGACTAACCAGAACACGAATGAGTACCTGGAG
AAGATCAAACAGCGACTGTTTGAGAACCTTAGAATGCTGCCGCACGCACCTGGGGTCCAA
ATGCAGGCGATTCCTGAGGACGCCATCCCTGAGGAGAGTGGCGATGAGGACGAAGACGAC
CCTGACAAGCGCATCTCGATCTGCTCCTCTGACAAACGAATTGCCTGTGAGGAAGAGTTC
TCCGATTCTGAAGAGGAGGGAGAGGGGGGCCGCAAGAACTCTTCCAACTTCAAAAAAGCC
AAGAGAGTCAAAACAGAGGATGAAAAAGAGAAAGACCCAGAGGAGAAGAAAGAAGTCACC
GAAGAGGAGAAAACCAAGGAGGAGAAGCCAGAAGCCAAAGGGGTCAAGGAGGAGGTCAAG
TTGGCCTGA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_004964 unedited
TTTAGNATTTGGCTACTATCATATAGGCGGCCCGCGATTCGGCACGAGGCTGACGGTAGG
GACGGGAGGCGAGCAAGATGGCGCAGACGCAGGGCACCCGGAGGAAAGTCTGTTACTACT
ACGACGGGGATGTTGGAAATTACTATTATGGACAAGGCCACCCAATGAAGCCTCACCGAA
TCCGCATGACTCATAATTTGCTGCTCAACTATGGTCTCTACCGAAAAATGGAAATCTATC
GCCCTCACAAAGCCAATGCTGAGGAGATGACCAAGTACCACAGCGATGACTACATTAAAT
TCTTGCGCTCCATCCGTCCAGATAACATGTCGGAGTACAGCAAGCAGATGCAGAGATTCA
ACGTTGGTGAGGACTGTCCAGTATTCGATGGCCTGTTTGAGTTCTGTCAGTTGTCTACTG
GTGGTTCTGTGGCAAGTGCTGTGAAACTTAATAAGCAGCAGACGGACATCGCTGTGAATT
GGGCTGGGGGCCTGCACCATGCAAAGAAGTCCGAGGCATCTGGCTTCTGTTACGTCAATG
ATATCGTCTTGGCCATCCTGGAACTGCTAAAGTATCACCAGAGGGTGCTGTACATTGACA
TTGATATTCACCATGGTGACGGCGTGGAAGAGGCCTTCTACACCACGGACCGGGTCATGA
CTGTGTCCTTTCATAAGTATGGAGAGTACTTCCCAGGAACTGGGGACCTACGGGGATATC
GGGCTGGGCAAGCAAGTATTATGCTGTTAACTACCCGCTCCGAGACCGGATTGATGACGA
GTCCTATGAGGCCATTTCCAAGCCGTCATGTCCAAGGAATGGNAGAGTTCCACCCTAGTG
CGGTGGGTCTACAGGGTGGCTCAGACTCCTATCTGGGGATCGGGTANGTTGCTTCATCTA
ACTTCAAAGACCCGCCCG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_004964 unedited
CAGAGTCGAGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTATAGAAAGGGACCATTTTAT
TACAAAGAGGCTCACAAAAATGAAAATAGTATCTCAAAAAGGAAACTAGACTAGCAACCT
CCACCTGCAGAATTAGGAGAAGACAGACAGAGGGCAGGCAGTGTTTCTTGGCTCACTTGA
GGCCAGTGGGAAGGTACTAATACAGAACCAATCTAAAAATGGCTGATGTTACTTTAGGAG
CCTGAAAAAAACAGGAGATCCTTGAAGACCCAGCCACCCCTTCTAGAATGTTCAATAAGG
GCACCTTTCCAAAGCTACTAAGCAGGCACTTGGCATTTCAGGAGTTTGTCTTATGGTTGC
ATAAAAGTATCCCTTTCACCCAGACCTGGCACCCTTTATGGTTCAAAGTTAAGAACGGGA
AGAATGGGTGGCAAGGTGGCTCCTGGAAGAGCTCACCCAGCACAGCTGCCCTGAGCTCGG
GGCCTTGGTTTCTGTCCCTGGGGATATTTATATTTAATAAATTTTTATATAAATTCCCCG
AGAACTAGAAAATATAAAATCTGAGGGGTTGGGGAAGAAACGTGAGGGACTCACCAGGAA
GCCAGAGCTGGAGAAGTCCATTCAGGCCAACTTGACCTCCTCCTTGACCCCTTTGGCTTC
TGGACTTCCCCTCCCTGGGTTTTTTCCTTCGGGAGACCTCCTTTTTCTCCTCTGGGCCTT
TTCTTTTTTTATCCCCGGTTTGGACTCTTTTGGGCTTTTTTGAAGTTGGAACAATTTTTG
CGGGCCCCCTTTTCTCCTTTTTATAATCGGAAAATCTTCTCTACAGGCATCCCTTTTCAA
AAACACCCACCAAGTCTTGCCAGGTGCCCTTCCCCCCCACCCCTTCCTTAGGTACGGCGC
CCATGATTTCCGCTTTGTCCCCCCCGTCGCGGATTTTTATGGCCCCAAACCGCCGCTTCC
CCCCTGTCCATCCCCGCCGTTTCACTTATATACCCGCCCCCCCCCACTTCCATTCCCCCC
C
Restriction Sites -     
Tag Tag Free
ACCN NM_004964
ORF Size 1449 bp
Insert Size 2200
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_004964.2, NP_004955
RefSeq Size 2091
Locus ID 3065
Cytogenetics 1p35.2-p35.1
Domains Hist_deacetyl
Protein Families Stem cell relevant signaling - DSL/Notch pathway, Stem cell - Pluripotency, Adult stem cells, Transcription Factors, Druggable Genome
Protein Pathways Cell cycle, Notch signaling pathway, Huntington's disease, Pathways in cancer, Chronic myeloid leukemia
Gene Summary Histone acetylation and deacetylation, catalyzed by multisubunit complexes, play a key role in the regulation of eukaryotic gene expression. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family and is a component of the histone deacetylase complex. It also interacts with retinoblastoma tumor-suppressor protein and this complex is a key element in the control of cell proliferation and differentiation. Together with metastasis-associated protein-2, it deacetylates p53 and modulates its effect on cell growth and apoptosis. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations