ROR1 (NM_005012) Human Untagged Clone

CAT#: SC117005

ROR1 (untagged)-Human receptor tyrosine kinase-like orphan receptor 1 (ROR1), transcript variant 1

USD 1,793.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name ROR1 (NM_005012) Human Untagged Clone
Symbol ROR1
Synonyms dJ537F10.1; NTRKR1
Vector pCMV6-XL6
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_005012 edited
ATGCACCGGCCGCGCCGCCGCGGGACGCGCCCGCCGCTCCTGGCGCTGCTGGCCGCGCTG
CTGCTGGCCGCACGCGGGGCTGCTGCCCAAGAAACAGAGCTGTCAGTCAGTGCTGAATTA
GTGCCTACCTCATCATGGAACATCTCAAGTGAACTCAACAAAGATTCTTACCTGACCCTT
GATGAACCAATGAATAACATCACCACGTCTCTGGGCCAGACAGCAGAACTGCACTGCAAA
GTCTCTGGGAATCCACCTCCCACCATCCGCTGGTTCAAAAATGATGCTCCTGTGGTCCAG
GAGCCCCGGAGGCTCTCCTTTCGGTCCACCATCTATGGCTCTCGGCTGCGGATTAGAAAC
CTCGACACCACAGACACAGGCTACTTCCAGTGCGTGGCAACAAACGGCAAGGAGGTGGTT
TCTTCCACTGGAGTCTTGTTTGTCAAGTTTGGCCCCCCTCCCACTGCAAGTCCAGGATAC
TCAGATGAGTATGAAGAAGATGGATTCTGTCAGCCATACAGAGGGATTGCATGTGCAAGA
TTTATTGGCAACCGCACCGTCTATATGGAGTCTTTGCACATGCAAGGGGAAATAGAAAAT
CAGATCACAGCTGCCTTCACTATGATTGGCACTTCCAGTCACTTATCTGATAAGTGTTCT
CAGTTCGCCATTCCTTCCCTGTGCCACTATGCCTTCCCGTACTGCGATGAAACTTCATCC
GTCCCAAAGCCCCGTGACTTGTGTCGCGATGAATGTGAAATCCTGGAGAATGTCCTGTGT
CAAACAGAGTACATTTTTGCAAGATCAAATCCCATGATTCTGATGAGGCTGAAACTGCCA
AACTGTGAAGATCTCCCCCAGCCAGAGAGCCCAGAAGCTGCGAACTGTATCCGGATTGGA
ATTCCCATGGCAGATCCTATAAATAAAAATCACAAGTGTTATAACAGCACAGGTGTGGAC
TACCGGGGGACCGTCAGTGTGACCAAATCAGGGCGCCAGTGCCAGCCATGGAATTCCCAG
TATCCCCACACACACACTTTCACCGCCCTTCGTTTCCCAGAGCTGAATGGAGGCCATTCC
TACTGCCGCAACCCAGGGAATCAAAAGGAAGCTCCCTGGTGCTTCACCTTGGATGAAAAC
TTTAAGTCTGATCTGTGTGACATCCCAGCTTGCGATTCAAAGGATTCCAAGGAGAAGAAT
AAAATGGAAATCCTGTACATACTAGTGCCAAGTGTGGCCATTCCCCTGGCCATTGCTTTA
CTCTTCTTCTTCATTTGCGTCTGTCGGAATAACCAGAAGTCATCGTCGGCACCAGTCCAG
AGGCAACCAAAACACGTCAGAGGTCAAAATGTAGAGATGTCAATGCTGAATGCATATAAA
CCCAAGAGCAAGGCTAAAGAGCTACCTCTTTCTGCTGTACGCTTTATGGAAGAATTGGGT
GAGTGTGCCTTTGGAAAAATCTATAAAGGCCATCTCTATCTCCCAGGCATGGACCATGCT
CAGCTGGTTGCTATCAAGACCTTGAAAGACTATAACAACCCCCAGCAATGGATGGAATTT
CAACAAGAAGCCTCCCTAATGGCAGAACTGCACCACCCCAATATTGTCTGCCTTCTAGGT
GCCGTCACTCAGGAACAACCTGTGTGCATGCTTTTTGAGTATATTAATCAGGGGGATCTC
CATGAGTTCCTCATCATGAGATCCCCACACTCTGATGTTGGCTGCAGCAGTGATGAAGAT
GGGACTGTGAAATCCAGCCTGGACCACGGAGATTTTCTGCACATTGCAATTCAGATTGCA
GCTGGCATGGAATACCTGTCTAGTCACTTCTTTGTCCACAAGGACCTTGCAGCTCGCAAT
ATTTTAATCGGAGAGCAACTTCATGTAAAGATTTCAGACTTGGGGCTTTCCAGAGAAATT
TACTCCGCTGATTACTACAGGGTCCAGAGTAAGTCCTTGCTGCCCATTCGCTGGATGCCC
CCTGAAGCCATCATGTATGGCAAATTCTCTTCTGATTCAGATATCTGGTCCTTTGGGGTT
GTCTTGTGGGAGATTTTCAGTTTTGGACTCCAGCCATATTATGGATTCAGTAACCAGGAA
GTGATTGAGATGGTGAGAAAACGGCAGCTCTTACCATGCTCTGAAGACTGCCCACCCAGA
ATGTACAGCCTCATGACAGAGTGCTGGAATGAGATTCCTTCTAGGAGACCAAGATTTAAA
GATATTCACGTCCGGCTTCGGTCCTGGGAGGGACTCTCAAGTCACACAAGCTCTACTACT
CCTTCAGGGGGAAATGCCACCACACAGACAACCTCCCTCAGTGCCAGCCCAGTGAGTAAT
CTCAGTAACCCCAGATATCCTAATTACATGTTCCCGAGCCAGGGTATTACACCACAGGGC
CAGATTGCTGGTTTCATTGGCCCGCCAATACCTCAGAACCAGCGATTCATTCCCATCAAT
GGATACCCAATACCTCCTGGATATGCAGCGTTTCCAGCTGCCCACTACCAGCCAACAGGT
CCTCCCAGAGTGATTCAGCACTGCCCACCTCCCAAGAGTCGGTCCCCAAGCAGTGCCAGT
GGGTCGACTAGCACTGGCCATGTGACTAGCTTGCCCTCATCAGGATCCAATCAGGAAGCA
AATATTCCTTTACTACCACACATGTCAATTCCAAATCATCCTGGTGGAATGGGTATCACC
GTTTTTGGCAACAAATCTCAAAAACCCTACAAAATTGACTCAAAGCAAGCATCTTTACTA
GGAGACGCCAATATTCATGGACACACCGAATCTATGATTTCTGCAGAACTGTAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_005012 unedited
ATCCTTCCCGCCCGTTGCCGCATTGGGCGGTAGGCGTGTACGGTGGGAAGGTCTATATAA
GCAGAGCTCATTTAGGTGACACTATAGAATACAAGCTACTTGTTCTTTTTGCAGCGGCCG
CGAATTCGGCACGAGGGAGCGTGGAGAGCTGGAGCAGCCGCCACCGCCGCCGCCGAGGGA
GCCCCGGGACGGCAGCCCCTGGGCGCAGGGTGCGCTGTTCTCGGAGTCCGACCCAGGGCG
ACTCACGCCCACTGGTGCGACCCGGACAGCCTGGGACTGACCCGCCGGCCCAGGCGAGGC
TGCAGCCAGAGGGCTGGGAAGGGATCGCGCTCGCGGCATCCAGAGGCGGCCAGGCGGAGG
CGAGGGAGCAGGTTAGAGGGACAAAGAGCTTTGCAGACGTCCCCGGCGTCCTGCGAGCGC
CAGCGGCCGGGACGAGGCGGCCGGGAGCCCGGGAAGAGCCCGTGGATGTTCTGCGCGCGG
CCTGGGAGCCGCCGCCGCCGCCGCCTCAGCGAGAGGAGGAATGCACCGGCCGCGCCGCCG
CGGGACGCGCCCGCCGCTCCTGGCGCTGCTGGCCGCGCTGCTGCTGGCCGCACGCGGAGC
TGCTGCCCAAGAAACAGAGCTGTCAGTCAGTGCTGAATTAGTGCCTACCTCATCATGGAA
CATCTCAAGTGAACTCAACANAGATTCTTACCTGACCCTTGATGAACCAATGAATAACAT
CACCACGTCTCTAGGCCAGACAGCAGAACTGCACTGCANAGTCTCTGGGAATCCACNNCT
CCACATCCGCTGGGTCAAAAATGATGCTCCTGTGGTCCAGGAGCCCCGGAGGGCTCTCTT
TCGTTCAACATCTATGGCTCTCGGCTGGCGGATTANAAACTCGACACCCCAGACCAAGCT
ACTTTCAGTGCGTGGCAACA
3' Read Nucleotide Sequence
>OriGene 3' read for NM_005012 unedited
AAATTCGCGGTGTCTGTCCCTGCTTGGTAAGACACATGNAACTTCACANAGGTACTTGTT
GCGATGTCTGCTAAATGAGAACCTTACTTTAATAAAAACATTTGAATATAAATCTTTTCT
ACGGCCGTCTAGTTTGTCCTGTATACCACATTTACAAAAGTTGTGCATTTTACAGTTCTG
CAGAAATCATAGATTCGGTGTGTCCATGAATATTGGCGTCTCCTAGTAAAGATGCTTGCT
TTGAGTCAATTTTGTAGGGTTTTTGAGATTTGTTGCCAACAACGGTGATACCCATTCCAC
CAGGATGATTTGGAATTGACATGTGTGGTAGTAAAGGAATATTTGCTTCCTGATTGGATC
CTGATGAGGGCAAGCTAGTCACATGGCCAGTGCTAGTCGACCCACTGGCACTGCTTGGGG
ACCGACTCTTGGGAGGTGGGCAGTGCTGAATCACTCTGGGAGGACCTGTTGGCTGGTAGT
GGGCAGCATGAAACGCTGCATATCCAGGAGGTATTGGGTATCCATTGATGGGAATGAATC
GCTGGTTCTGAGGTATTGGCGGGCCAATGAAACCAGCCATCTGGCCCTGTGGTGTAATAC
CCTGGCTCGGGAACATGTAATTAGGATATCTGGGGTTACTGAGATTACTCACTGNGCTGG
CACTGAGGGAGGTTGTCTGTGTGGTGGCATTTCCCCCTGAAGGAGTAGTAGAGCTTGTGT
GACTTGAGAGTCCCTNCCAGGACCGAAGCCCNACGTGAATATCTTTAAATCTTGGTCTTC
TAGAAGGAATCTCATTCCAGCACTCTGTCATTGAGCTGTACATTCTGGGTGGGCAGTCTT
CANAGCATGTTAAGAGCTGCCGNTTTCTCACCATCTCATCACTTTCTGGTTACTGAATCC
ATATTATGG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_005012
ORF Size 2814 bp
Insert Size 3500
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_005012.1, NP_005003
RefSeq Size 5871
Locus ID 4919
Cytogenetics 1p31.3
Domains KR, Fz, pkinase, TyrKc, S_TKc, ig, IGc2, IG
Protein Families Protein Kinase, Transmembrane, Druggable Genome
Gene Summary This gene encodes a receptor tyrosine kinase-like orphan receptor that modulates neurite growth in the central nervous system. The encoded protein is a glycosylated type I membrane protein that belongs to the ROR subfamily of cell surface receptors. It is a pseudokinase that lacks catalytic activity and may interact with the non-canonical Wnt signalling pathway. This gene is highly expressed during early embryonic development but expressed at very low levels in adult tissues. Increased expression of this gene is associated with B-cell chronic lymphocytic leukaemia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2012].
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations