HNRPH1(HNRNPH1) (NM_005520) Human Untagged Clone

CAT#: SC116705

HNRNPH1 (untagged)-Human heterogeneous nuclear ribonucleoprotein H1 (H) (HNRNPH1)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name HNRPH1(HNRNPH1) (NM_005520) Human Untagged Clone
Symbol HNRNPH1
Synonyms hnRNPH; HNRPH; HNRPH1
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC116705 sequence for NM_005520 edited (data generated by NextGen Sequencing)
ATGATGTTGGGCACGGAAGGTGGAGAGGGATTCGTGGTGAAGGTCCGGGGCTTGCCCTGG
TCTTGCTCGGCCGATGAAGTGCAGAGGTTTTTTTCTGACTGCAAAATTCAAAATGGGGCT
CAAGGTATTCGTTTCATCTACACCAGAGAAGGCAGACCAAGTGGCGAGGCTTTTGTTGAA
CTTGAATCAGAAGATGAAGTCAAATTGGCCCTGAAAAAAGACAGAGAAACTATGGGACAC
AGATATGTTGAAGTATTCAAGTCAAACAACGTTGAAATGGATTGGGTGTTGAAGCATACT
GGTCCAAATAGTCCTGACACGGCCAATGATGGCTTTGTACGGCTTAGAGGACTTCCCTTT
GGATGTAGCAAGGAAGAAATTGTTCAGTTCTTCTCAGGGTTGGAAATCGTGCCAAATGGG
ATAACATTGCCGGTGGACTTCCAGGGGAGGAGTACGGGGGAGGCCTTCGTGCAGTTTGCT
TCACAGGAAATAGCTGAAAAGGCTCTAAAGAAACACAAGGAAAGAATAGGGCACAGGTAT
ATTGAAATCTTTAAGAGCAGTAGAGCTGAAGTTAGAACTCATTATGATCCACCACGAAAG
CTTATGGCCATGCAGCGGCCAGGTCCTTATGACAGACCTGGGGCTGGTAGAGGGTATAAC
AGCATTGGCAGAGGAGCTGGCTTTGAGAGGATGAGGCGTGGTGCTTATGGTGGAGGCTAT
GGAGGCTATGATGATTACAATGGCTATAATGATGGCTATGGATTTGGGTCAGATAGATTT
GGAAGAGACCTCAATTACTGTTTTTCAGGAATGTCTGATCACAGATACGGGGATGGTGGC
TCTACTTTCCAGAGCACAACAGGACACTGTGTACACATGCGGGGATTACCTTACAGAGCT
ACTGAGAATGACATTTATAATTTTTTTTCACCGCTCAACCCTGTGAGAGTACACATTGAA
ATTGGTCCTGATGGCAGAGTAACTGGTGAAGCAGATGTCGAGTTCGCAACTCATGAAGAT
GCTGTGGCAGCTATGTCAAAAGACAAAGCAAATATGCAACACAGATATGTAGAACTCTTC
TTGAATTCTACAGCAGGAGCAAGCGGTGGTGCTTACGAACACAGATATGTAGAACTCTTC
TTGAATTCTACAGCAGGAGCAAGCGGTGGTGCTTATGGTAGCCAAATGATGGGAGGCATG
GGCTTGTCAAACCAGTCCAGCTACGGGGGCCCAGCCAGCCAGCAGCTGAGTGGGGGTTAC
GGAGGCGGCTACGGTGGCCAGAGCAGCATGAGTGGATACGACCAAGTTTTACAGGAAAAC
TCCAGTGATTTTCAATCAAACATTGCATAG

Clone variation with respect to NM_005520.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_005520 unedited
CCTTTCGGATTTGTATACGTTTCACTATAGGCGGCCGCGAATTCGCACGAGGCAGAAGTC
GCGTGTCTAGGTGAGTCGCGGTGGGTCCTCGCTTGCAGTTCAGCGACCACGTTTGTTTCG
ACGCCGGACCGCGTAAGAGACGATGATGTTGGGCACGGAAGGTGGAGAGGGATTCGTGGT
GAAGGTCCGGGGCTTGCCCTGGTCTTGCTCGGCCGATGAAGTGCAGAGGTTTTTTTCTGA
CTGCAAAATTCAAAATGGGGCTCAAGGTATTCGTTTCATCTACACCAGAGAAGGCAGACC
AAGTGGCGAGGCTTTTGTTGAACTTGAATCAGAAGATGAAGTCAAATTGGCCCTGAAAAA
AGACAGAGAAACTATGGGACACAGATATGTTGAAGTATTCAAGTCAAACAACGTTGAAAT
GGATTGGGTGTTGAAGCATACTGGTCCAAATAGTCCTGACACGGCCAATGATGGCTTTGT
ACGGCTTAGAGGACTTCCCTTTGGATGTAGCAAGGAAGAAATTGTTCAGTTCTTCTCAGG
GTTGGAAATCGTGCCAAATGGGATAACATTGCCGGTGGACTTCCAGGGGAGGAGTACGGN
GGAGGCCTTCGTGCAGTTTGCTTCACAGGAAATAGCTGAAAAAGGCTCTAAAGAAACACA
AGGAAAGAATAGGGCACAGGTATATTGAAATCTTTAAGAGCAGTAGAGCTGAAGTTAGAA
CTCATTATGATCCACCACGAAAGCTTATGCCCATGCAGCGGCCAGGTCCTTATGACAGAC
CCTGGGCTGGTAGAGGGTATAACAGCATTGGCAGAAGAGCTGGCTCTGAGAGATGAGGCC
TGTGCTAATGGTGGAGCTATGGAGCTATGAGATACATGGCTATATGAGGCTAGGT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_005520 unedited
CCGCGGCCGCAATCTANAGTCGAGTTTTTTTTTTTTTTTTTTGCAGTTTTTAAAAGGAGG
ATTTATTTGACAAGTTTCACTTAGCGCAATATACCTAAAAGGAAATCACAATACAATGAA
AGATTTAAATCAAGGCCTCAGAATTTCATACAAACACCAAGACCAAAATCCTAAGTATTG
GTATTGCGTCTCAAATTTTTCCCATTAACTTAAAAAAAAAAAAAGCTTAAACTTACGTGC
CTTACAGGTTATTAAATGAAACTAGAATTAACAAACATGCCAAAATGTTTCACTTTTAAT
AGTAGACACAGCTCCTATATTGTTTTACAAAAAAATAAAAGCATGTCTTTCAACATGCAT
CCAAAACAGTGTTCAATTTAACGTGGCAAAGGGCAACATTTAACATAATTCAACTGCTTT
TACCTAAATACGCTTACTGCTTAAGTACATCCTATAACTAACTTGAGAAAAGCTGGAACT
TAAGTTTAACAGTTATAGTTTACTCAGCTTCACTGTTACATCCTAGATGAGTATTGTATT
CAAAAATACTGGGCCTTAAGTCTTCATAACAATCCTGATTTCCACTTAGAGTAAGCATAA
ATCACAAGCTTGTATTGCAGAAACTGTTAAACTGAAAGTTTCTTAAAGAANAAAAAAAAA
AAAAAAAAAGGTTGACCAAGAGTCAGTGATCAGGATCGATCAATTACATTCCCCATCCAC
CACTCATACTGGACATGCTAGACAACCCTCCCATTCCGTTCACGCCCATAAATGCCCGCC
TTCCACTACTGTAGGAGCCTGCTGTCACTGCTCCTTGGTACTTATGCATGTTTGATTGGA
AATCACTGAAGTTTCCTGTAAAACTGGTCGGATCCCTCATGCTGTTTTGGCCACCTTAAC
CCCCTCCTTACCCCCT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_005520
ORF Size 1350 bp
Insert Size 2570
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_005520.1, NP_005511
RefSeq Size 2201
RefSeq ORF 1350
Locus ID 3187
Cytogenetics 5q35.3
Domains rrm
Gene Summary This gene encodes a member of a subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins that complex with heterogeneous nuclear RNA. These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some may shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has three repeats of quasi-RRM domains that bind to RNA and is very similar to the family member HNRPF. This gene may be associated with hereditary lymphedema type I. Alternatively spliced transcript variants have been described [provided by RefSeq, Mar 2012]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations