PYGM (NM_005609) Human Untagged Clone

CAT#: SC116630

Reviews ()
Write a review

PYGM (untagged)-Human phosphorylase, glycogen, muscle (PYGM), transcript variant 1



Reconstitution Protocol

USD 772.00

In Stock*

Size
    • 10 ug

Product images

Other products for "PYGM"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PYGM
Synonyms GSD5
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC116630 sequence for NM_005609 edited (data generated by NextGen Sequencing)
ATGTCCCGGCCCCTGTCAGACCAAGAGAAAAGAAAGCAAATCAGTGTGCGTGGCCTGGCC
GGCGTGGAGAACGTGACTGAGCTGAAAAAGAACTTCAACCGGCACCTGCATTTCACACTC
GTAAAGGACCGCAATGTGGCCACCCCACGAGACTACTACTTTGCTCTGGCCCATACCGTG
CGCGACCACCTCGTGGGGCGCTGGATCCGCACGCAGCAGCACTACTATGAGAAGGACCCC
AAGAGGATCTACTACCTGTCTTTAGAGTTCTATATGGGACGGACGCTACAGAACACCATG
GTGAACCTGGCCTTAGAGAATGCCTGTGACGAGGCCACCTACCAGCTGGGCCTGGACATG
GAGGAGCTGGAGGAAATTGAGGAGGATGCGGGGCTGGGCAACGGGGGCCTGGGCCGGCTG
GCAGCCTGCTTTCTTGACTCCATGGCAACACTGGGCCTGGCCGCCTATGGCTACGGGATT
CGCTATGAGTTTGGGATTTTTAACCAGAAGATCTCCGGGGGCTGGCAGATGGAGGAGGCC
GATGACTGGCTTCGCTACGGCAACCCCTGGGAGAAGGCCCGGCCCGAGTTCACGCTACCT
GTGCACTTCTACGGCCATGTGGAGCACACCAGCCAGGGTGCCAAGTGGGTGGACACACAG
GTGGTACTGGCCATGCCCTACGATACGCCCGTGCCTGGCTATCGCAACAATGTTGTCAAC
ACCATGCGCCTCTGGTCTGCCAAGGCTCCCAATGACTTCAACCTCAAGGACTTCAATGTC
GGTGGCTACATCCAGGCTGTGTTGGACCGAAACCTGGCGGAGAACATCTCTCGTGTCCTG
TACCCCAATGATAATTTCTTCGAAGGGAAGGAGCTGCGGCTGAAGCAGGAGTATTTCGTG
GTGGCTGCCACCCTCCAGGACATCATCCGTCGCTTCAAGTCTTCCAAGTTCGGCTGCCGT
GATCCCGTGCGCACGAACTTCGATGCCTTCCCAGATAAGGTGGCCATCCAGCTCAATGAC
ACCCACCCCTCCCTGGCCATCCCCGAGCTGATGAGGATCCTGGTGGACCTGGAACGGATG
GACTGGGACAAGGCGTGGGATGTGACAGTGAGGACCTGTGCCTACACCAACCACACGGTG
CTGCCCGAGGCCCTGGAGCGCTGGCCGGTGCACCTCTTGGAGACGCTGCTGCCGCGGCAC
CTCCAGATCATCTACGAGATCAACCAGCGCTTCCTCAACCGGGTGGCGGCCGCATTCCCA
GGGGACGTAGACCGGCTGCGGCGCATGTCGCTGGTGGAGGAGGGCGCAGTGAAGCGCATC
AACATGGCACACCTGTGCATCGCGGGGTCGCACGCCGTCAACGGCGTGGCGCGCATCCAC
TCCGAGATCCTCAAGAAGACCATCTTCAAAGACTTCTATGAGCTGGAGCCTCATAAGTTC
CAGAATAAGACCAACGGCATCACCCCTCGGCGCTGGCTGGTTCTGTGTAACCCCGGGCTG
GCAGAGGTCATTGCTGAGCGCATCGGGGAGGACTTCATCTCTGACCTGGACCAGCTGCGC
AAACTGCTCTCCTTTGTGGATGATGAAGCTTTCATTCGGGATGTGGCCAAAGTGAAGCAG
GAAAACAAGTTGAAGTTTGCTGCCTACCTAGAGAGGGAATACAAAGTCCACATCAACCCC
AACTCACTCTTCGACATCCAGGTGAAGCGGATTCACGAATATAAACGACAGCTCCTCAAC
TGCCTCCATGTCATCACCCTGTACAACCGCATCAAGAGGGAGCCCAATAAGTTTTTTGTG
CCTCGGACTGTGATGATTGGAGGGAAGGCTGCACCTGGGTACCACATGGCCAAGATGATC
ATCAGACTCGTCACAGCCATCGGGGATGTGGTCAACCATGACCCGGCAGTGGGTGACCGC
CTCCGTGTCATCTTCCTGGAGAACTACCGAGTCTCACTGGCCGAGAAAGTGATCCCAGCT
GCAGACCTCTCTGAGCAGATCTCCACTGCGGGCACTGAAGCCTCAGGCACCGGCAACATG
AAGTTCATGCTCAACGGGGCTCTGACCATTGGCACCATGGACGGGGCCAATGTGGAGATG
GCAGAAGAGGCGGGAGAGGAAAACTTCTTCATCTTTGGCATGCGGGTGGAGGATGTGGAT
AAGCTTGACCAAAGAGGGTACAATGCCCAGGAGTACTACGATCGCATTCCTGAGCTTCGG
CAGGTCATTGAGCAGCTGAGCAGTGGCTTCTTCTCCCCCAAACAGCCCGACCTGTTCAAG
GACATTGTCAATATGCTCATGCACCATGACCGGTTTAAAGTCTTCGCAGATTATGAAGAC
TACATTAAATGCCAGGAGAAAGTCAGCGCCTTGTACAAGAACCCAAGAGAGTGGACGCGG
ATGGTGATCCGGAACATAGCCACCTCTGGCAAGTTCTCCAGTGACCGCACCATTGCCCAG
TATGCCCGGGAGATCTGGGGTGTGGAGCCTTCCCGCCAGCGCCTGCCAGCCCCGGATGAG
GCCATCTGA

Clone variation with respect to NM_005609.2
>OriGene 5' read for NM_005609 unedited
GTTGGATTTTGTATACGACTTATATAGGCGGCCGCGCAATTCGCACGAGGCTGGAGGCAG
TGCTGAGGCCGCCGTCCCCTCTACCATCAGTCCAGTCCGGCCCGCCCTCCTGCAGCCATG
TCCCGGCCCCTGTCAGACCAAGAGAAAAGAAAGCAAATCAGTGTGCGTGGCCTGGCCGGC
GTGGAGAACGTGACTGAGCTGAAAAAGAACTTCAACCGGCACCTGCATTTCACACTCGTA
AAGGACCGCAATGTGGCCACCCCACGAGACTACTACTTTGCTCTGGCCCATACCGTGCGC
GACCACCTCGTGGGGCGCTGGATCCGCACGCAGCAGCACTACTATGAGAAGGACCCCAAG
AGGATCTACTACCTGTCTTTAGAGTTCTATATGGGACGGACGCTACAGAACACCATGGTG
AACCTGGCCTTAGAGAATGCCTGTGACGAGGCCACCTACCAGCTGGGCCTGGACATGGAG
GAGCTGGAGGAAATTGAGGAGGATGCGGGGCTGGGCAACGGGGGCCTGGGCCGGCTGGCA
GCCTGCTTTCTTGACTCCATGGCAACACTGGGCCTGGCCGCCTATGGCTACGGGATTCGC
TATGAGTTTGGGATTTTTAACCAGAAGATCTCCGGGGGCTGGCAGATGGAGGAGGCCGAT
GACTGGCTTCGCTACGGCAACCCCTGGGAGAAGGCCCGGCCCGAGTTCACGCTACCTGTG
CACTTCTACGGCCATGTGGAGCACACCAGCCAGGGTGCCAAGTGGGGTGACACACANGTG
GTACTGGCCATGCCCTACGATACGCCCGTGCCTGGCTATCGCAACATGGTTGTCAACACA
TGCGCCTCTGGTCTGCCAAGGCTCCNATGACTTNNCACCTCAGGACTTCAATGTCGTGGC
TACATCCAGNCTGTGTTGGACCGAAACCTGGCGGAGA
>OriGene 3' read for NM_005609 unedited
NNNTTTACTCTGGAACCGCGGCCGCAATCTAGGATCGAGTTTTTTTTTTTTTTTTTTTTT
CCCAGGGAGAATGAATTTATTAGGGAGTGGGTGCAGTTGGTCAGACCCCATAAATAGGAG
GGGACCGGGAGCCCGAGGACGGAAGGGGGCCCGTGTCCTTAGTCACGCTGGACACTGGGA
CATTGAGAGTGGGGAAAATGAGGGTTCCAGGAGGGGCTTAAAGATCTAACTCCAGTACCC
CACCCTCTGCATGAGGTGCTGGGGCTGGCCCAAGAGAGTGTGACAGACTCAAGGGCTGGT
TTGGGGTCTGGTCTGGAGGCTCAAATGGCCTCATCCGGGGCTGGCAGGCGCTGGCGGGAA
GGCTCCACACCCCAGATCTCCCGGGCATACTGGGCAATGGTGCGGTCACTGGAGAACTTG
CCAGAGGTGGCTATGTTCCGGATCACCATCCGCGTCCACTCTCTTGGGTTCTTGTACAAG
GCGCTGACTTTCTCCTGGCATTTAATGTAGTCTTCATAATCTGCGAAGACTTTAAACCGG
TCATGGTGCATGAGCATATTGACAATGTCCTTGAACAGGTCGGGCTGTTTGGGGGAGAAG
AAGCCACTGCTCAGCTGCTCAATGACCTGCCGAAGCTCAGGAATGCGATCGTAGTACTCC
TGGGCATTGTACCCTCTTTGGTCAAGCTTATCCACATCCTCCACCCGCATGCCAAAGATG
AAGAAGTTTTCCTCTCCCGCCTCTTCTGCCATCTCCACATTGGGCCCCGTNCATGGTGCC
ANATGGTCANAGCCCCCGTTGAGCATGAACTTNCATGTNGCCGTGCCTGAAGCTTCANTG
CCCGCAGTGGAGATCTGCTCANAAAGTCTGGAGCTGGGATCACTTTCTGGCCAGTGAGAT
CGGTAGTTCTCCAGGAAGATGACCCGAGCGGGCACCCAT
Restriction Sites NotI-NotI     
ACCN NM_005609
Insert Size 2780 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005609.1, NP_005600.1
RefSeq Size 3447 bp
RefSeq ORF 2529 bp
Locus ID 5837
UniProt ID P11217
Cytogenetics 11q13.1
Domains phosphorylase
Protein Families Druggable Genome
Protein Pathways Insulin signaling pathway, Starch and sucrose metabolism
Gene Summary This gene encodes a muscle enzyme involved in glycogenolysis. Highly similar enzymes encoded by different genes are found in liver and brain. Mutations in this gene are associated with McArdle disease (myophosphorylase deficiency), a glycogen storage disease of muscle. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Sep 2009]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer protein (isoform 1).
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.