Snf1lk2 (SIK2) (NM_015191) Human Untagged Clone

CAT#: SC116431

Reviews ()
Write a review

SIK2 (untagged)-Human salt-inducible kinase 2 (SIK2)



Reconstitution Protocol

USD 849.00

In Stock*

Size
    • 10 ug

Product images

Other products for "SIK2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SIK2
Synonyms LOH11CR1I; QIK; SIK-2; SNF1LK2
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_015191 edited
ATGGTCATGGCGGATGGCCCGAGGCACTTGCAGCGCGGGCCGGTCCGGGTGGGGTTCTAC
GACATCGAGGGCACGCTGGGCAAGGGCAACTTCGCTGTGGTGAAGCTGGGGCGGCACCGG
ATCACCAAGACGGAGGTGGCAATAAAAATAATCGATAAGTCTCAGCTGGATGCAGTGAAC
CTTGAGAAAATCTACCGAGAAGTACAAATAATGAAAATGTTAGACCACCCTCACATAATC
AAACTTTATCAGGTAATGGAGACCAAAAGTATGTTGTACCTTGTGACAGAATATGCCAAA
AATGGAGAAATTTTTGACTATCTTGCTAATCATGGCCGGTTAAATGAGTCTGAAGCCAGG
CGAAAATTCTGGCAAATCCTGTCTGCTGTTGATTATTGTCATGGTCGGAAGATTGTGCAC
CGTGACCTCAAAGCTGAAAATCTCCTGCTGGATAACAACATGAATATCAAAATAGCAGAT
TTCGGTTTTGGAAATTTCTTTAAAAGTGGTGAACTGCTGGCAACATGGTGTGGCAGCCCC
CCTTATGCAGCCCCAGAAGTCTTTGAAGGGCAGCAGTATGAAGGACCACAGCTGGACATC
TGGAGTATGGGAGTTGTTCTTTATGTCCTTGTCTGTGGAGCTCTGCCCTTTGATGGACCG
ACTCTTCCAATTTTGAGGCAGAGGGTTCTGGAAGGAAGATTCCGGATTCCGTATTTCATG
TCAGAAGATTGCGAGCACCTTATCCGAAGGATGTTGGTCCTAGACCCATCCAAACGGCTA
ACCATAGCCCAAATCAAGGAGCATAAATGGATGCTCATAGAAGTTCCTGTCCAGAGACCT
GTTCTCTATCCACAAGAGCAAGAAAATGAGCCATCCATCGGGGAGTTTAATGAGCAGGTT
CTGCGACTGATGCACAGCCTTGGAATAGATCAGCAGAAAACCATTGAGTCTTTGCAGAAC
AAGAGCTATAACCACTTTGCTGCCATTTATTTCTTGTTGGTGGAGCGCCTGAAATCACAT
CGGAGCAGTTTCCCAGTGGAGCAGAGACTTGATGGCCGCCAGCGTCGGCCTAGCACCATT
GCTGAGCAAACAGTTGCCAAGGCACAGACTGTGGGGCTCCCAGTGACCATGCATTCACCG
AACATGAGGCTGCTGCGATCTGCCCTCCTCCCCCAGGCATCCAACGTGGAGGCCTTTTCA
TTTCCAGCATCTGGCTGTCAGGCGGAAGCTGCATTCATGGAAGAAGAGTGTGTGGACACT
CCAAAGGTCAATGGCTGTCTGCTTGACCCTGTGCCTCCTGTCCTGGTGCGGAAGGGATGC
CAGTCACTGCCCAGCAACATGATGGAGACCTCCATTGACGAAGGGCTGGAGACAGAAGGA
GAGGCCGAGGAAGACCCCGCTCATGCCTTTGAGGCATTTCAGTCCACACGCAGCGGGCAG
AGACGGCACACTCTGTCAGAAGTGACCAATCAACTGGTCGTGATGCCTGGGGCAGGGAAA
ATTTTCTCCATGAATGACAGCCCCTCCCTTGACAGTGTGGACTCTGAGTATGATATGGGG
TCTGTTCAGAGGGACCTGAACTTTCTGGAAGACAACCCTTCCCTTAAGGACATCATGTTA
GCCAATCAGCCTTCACCCCGCATGACATCTCCCTTCATAAGCCTGAGACCTACCAACCCA
GCCATGCAGGCTCTGAGCTCCCAGAAACGAGAGGTCCACAACAGGTCTCCAGTGAGCTTC
AGAGAGGGCCGCAGAGCATCAGATACCTCCCTCACCCAGGGAATTGTAGCATTTAGACAA
CATCTTCAGAATCTGGCTAGAACCAAAGGAATTCTAGAGTTGAACAAAGTGCAGTTGTTG
TATGAACAAATAGGACCGGAGGCAGACCCTAACCTGGCGCCGGCGGCTCCTCAGCTCCAG
GACCTTGCTAGCAGCTGCCCTCAGGAAGAAGTTTCTCAGCAGCAGGAAAGCGTCTCCACT
CTCCCTGCCAGCGTGCATCCCCAGCTGTCCCCACGGCAGAGCCTGGAGACCCAGTACCTG
CAGCACAGACTCCAGAAGCCCAGCCTTCTGTCAAAGGCCCAGAACACCTGTCAGCTTTAT
TGCAAAGAACCACCGCGGAGCCTTGAGCAGCAGCTGCAGGAACATAGGCTCCAGCAGAAG
CGACTCTTTCTTCAGAAGCAGTCTCAACTGCAGGCCTATTTTAATCAGATGCAGATAGCA
GAGAGCTCCTACCCACAGCCAAGTCAGCAGCTGCCCCTTCCCCGCCAGGAGACTCCACCG
CCTTCTCAGCAGGCCCCACCGTTCAGCCTGACCCAGCCCCTGAGCCCCGTCCTGGAGCCT
TCCTCCGAGCAGATGCAATACAGCCCTTTCCTCAGCCAGTACCAAGAGATGCAGCTTCAG
CCCCTGCCCTCCACTTCCGGTCCCCGGGCTGCTCCTCCTCTGCCCACGCAGCTACAGCAG
CAGCAGCCGCCACCGCCACCACCCCCTCCACCACCACGACAGCCAGGAGCTGCCCCAGCC
CCCTTACAGTTCTCCTATCAGACTTGTGAGCTGCCAAGCGCTGCTTCCCCTGCGCCAGAC
TATCCCACTCCCTGTCAGTATCCTGTGGATGGAGCCCAGCAGAGCGACCTAACGGGGCCA
GACTGTCCCAGAAGCCCAGGACTGCAAGAGGCCCCCTCCAGCTACGACCCACTAGCCCTC
TCTGAGCTACCTGGACTCTTTGATTGTGAAATGCTAGACGCTGTGGATCCACAACACAAC
GGGTATGTCCTGGTGAATTAG
>OriGene 5' read for NM_015191 unedited
NGGTCAAATTTGTATACGATCATATAGGCGGCCGCGNAATTCGCACGAGGCGGCGGCGCG
CGCCTGGCTGGGCCCTGCGGAGCGGGAGGGAAGGAGCGAAGGAGCGAAGGAGCAAGCGGA
GCGGCCGTCGCCCAAGCCAAGCCGCGCTGCCAACCCTCCCGCCCGCCCGCGCTCCTGTCC
GCCGTGTCTAGCAGCGGGGCCCAGCATGGTCATGGCGGATGGCCCGAGGCACTTGCAGCG
CGGGCCGGTCCGGGTGGGGTTCTACGACATCGAGGGCACGCTGGGCAAGGGCAACTTCGC
TGTGGTGAAGCTGGGGCGGCACCGGATCACCAAGACGGAGGTGGCAATAAAAATAATCGA
TAAGTCTCAGCTGGATGCAGTGAACCTTGAGAAAATCTACCGAGAAGTACAAATAATGAA
AATGTTAGACCACCCTCACATAATCAAACTTTATCAGGTAATGGAGACCAAAAGTATGTT
GTACCTTGTGACAGAATATGCCAAAAATGGAGAAATTTTTGACTATCTTGCTAATCATGG
CCGGTTAAATGAGTCTGAAGCCAGGCGAAAATTCTGGCAAATCCTGTCTGCTGTTGATTA
TTGTCATGGTCGGAAGATTGTGCACCGTGACCTCAAAGCTGAAAATCTCCTGCTGGATAA
CAACATGAATATCAAAATAGCAGATTTCGGTTNTGGAAATTTCTTTAAAAGTGGTGAACT
GCTGGCAACATGGGTGTGGCAGCCCCCCTTATGCAGCCCCAGAAGTCTTTGAAGGGCAGC
AGTATGAAGGACCACAGCTGGAATCTGGATATGGGGAAGNTGTTCCTTATGTGCCTGNCC
TGNGGAGCTCTGCCTTTTGATGGACCGACTCTTCCATTTGANGCCAAAGGGTTCTTGAAA
GGAAAATCCGGGATTCGAATTCATGGCAGNAAGATGCAAG
>OriGene 3' read for NM_015191 unedited
CTGGGACCGCAGCCGCATATTATAGTCGAGTTTTTTTTTCCTTTTTTTTGTAAGGGTTGG
TTAATTTTTATTAGTAATATAATGTTTGGCAGATGATCTGCTTAAATGGTTAACACATCT
GTGGTTCTTTCTTTGAATATTGCTGCAATACTTGAACATTTCATTACAAGTCAAAACTTT
AACGAAATTAAGAATGCTGATTCCCACATGGTGGAAAACTATCTCTGAAGTGACTTTGGA
TTTAGCATTGACATAAATGGAAACTGTTGGTTTCTACAGAAAAGAAAGAATTAAAGCATG
ATCTGGGGGAAAGGCACCGCACTACCACTTCACATGGGACAGAAAAGTTCATTTATCATG
TCCTTAAAATCTCTAAGCCCTATATGAAACTGTCCAAATATACAAAGCTCAATAAACTAC
TAGCAACATATAGTGTAAGGCCAAAGTACTTATTACATCCGAAAAGAAACACAGGTACCC
TGGAGACCGACTGCCCGCAAGCCAGCACTGTCCACGAGAAACTGCCGGAAGAGCCTGTCT
TTCCTGGCCCAGGCCGGCGCCCTCGAACCCCCCCTGACCCACTGCCCCCTGCCTTCACGG
GGGCGGTTTTCTGTCCGTCCACTTGGGACACCCCTTGAATCCTGAACATACCCCTCCCAC
CCCCCCCCCCCAGGCCCCTTATGCCAGGGGGTGGCCACCTGTTTTNCAAAGCGAACAACG
GGGGCTCTCGGGGCCCCCACCCCCCCGCCACCTCACCGGCCCTTGAAAACCAAATTTAGC
CCCCTTTTCTTTTCACCGACATTCGCCCACACCTTTACCACCCACCCCCACTCTTACCCC
CCATATCCCAACCTTAAACTCTCCTTTTATCTCCCCGCCCCAGATCCACCCCAGATCTTA
CTCCCTCCCACGTCACGACTCTACTATCCCTCCCCCCACCGACACACTTACCGCCCTACC
ACCCCCCACAACN
Restriction Sites NotI-NotI     
ACCN NM_015191
Insert Size 4730 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_015191.1, NP_056006.1
RefSeq Size 5694 bp
RefSeq ORF 2781 bp
Locus ID 23235
UniProt ID Q9H0K1
Cytogenetics 11q23.1
Protein Families Druggable Genome, Protein Kinase
Gene Summary Phosphorylates 'Ser-794' of IRS1 in insulin-stimulated adipocytes, potentially modulating the efficiency of insulin signal transduction. Inhibits CREB activity by phosphorylating and repressing TORCs, the CREB-specific coactivators.[UniProtKB/Swiss-Prot Function]
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.