CD28 (NM_006139) Human Untagged Clone

CAT#: SC116267

CD28 (untagged)-Human CD28 molecule (CD28)

USD 505


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name CD28 (NM_006139) Human Untagged Clone
Symbol CD28
Synonyms Tp44
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_006139, the custom clone sequence may differ by one or more nucleotides


ATGCTCAGGCTGCTCTTGGCTCTCAACTTATTCCCTTCAATTCAAGTAACAGGAAACAAGATTTTGGTGA
AGCAGTCGCCCATGCTTGTAGCGTACGACAATGCGGTCAACCTTAGCTGCAAGTATTCCTACAATCTCTT
CTCAAGGGAGTTCCGGGCATCCCTTCACAAAGGACTGGATAGTGCTGTGGAAGTCTGTGTTGTATATGGG
AATTACTCCCAGCAGCTTCAGGTTTACTCAAAAACGGGGTTCAACTGTGATGGGAAATTGGGCAATGAAT
CAGTGACATTCTACCTCCAGAATTTGTATGTTAACCAAACAGATATTTACTTCTGCAAAATTGAAGTTAT
GTATCCTCCTCCTTACCTAGACAATGAGAAGAGCAATGGAACCATTATCCATGTGAAAGGGAAACACCTT
TGTCCAAGTCCCCTATTTCCCGGACCTTCTAAGCCCTTTTGGGTGCTGGTGGTGGTTGGTGGAGTCCTGG
CTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATTATTTTCTGGGTGAGGAGTAAGAGGAGCAGGCTCCT
GCACAGTGACTACATGAACATGACTCCCCGCCGCCCCGGGCCCACCCGCAAGCATTACCAGCCCTATGCC
CCACCACGCGACTTCGCAGCCTATCGCTCCTGA


Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_006139
ORF Size 663 bp
Insert Size 3600
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_006139.1, NP_006130
RefSeq Size 3804
RefSeq ORF 663
Locus ID 940
Cytogenetics 2q33.2
Domains IGv
Protein Families Transmembrane, Druggable Genome
Protein Pathways Cell adhesion molecules (CAMs), T cell receptor signaling pathway, Type I diabetes mellitus, Autoimmune thyroid disease, Systemic lupus erythematosus, Allograft rejection, Graft-versus-host disease, Viral myocarditis
Gene Summary The protein encoded by this gene is essential for T-cell proliferation and survival, cytokine production, and T-helper type-2 development. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2011]
Transcript Variant: This variant (1) represents the predominant transcript, and encodes the longest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations