GPR75 (NM_006794) Human Untagged Clone

CAT#: SC115852

GPR75 (untagged)-Human G protein-coupled receptor 75 (GPR75)

USD 505


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name GPR75 (NM_006794) Human Untagged Clone
Symbol GPR75
Synonyms GPRchr2; WI31133
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_006794, the custom clone sequence may differ by one or more nucleotides


ATGAACTCAACAGGCCACCTTCAGGATGCCCCCAATGCCACCTCGCTCCATGTGCCTCACTCACAGGAAG
GAAACAGCACCTCTCTCCAGGAGGGTCTTCAGGATCTCATCCACACAGCCACCTTGGTGACCTGTACTTT
TCTACTGGCGGTCATCTTCTGCCTGGGTTCCTATGGCAACTTCATTGTCTTCTTGTCCTTCTTCGATCCA
GCCTTCAGGAAATTCAGAACCAACTTTGATTTCATGATCCTGAACCTGTCCTTCTGTGACCTCTTCATTT
GTGGAGTGACAGCCCCCATGTTCACCTTTGTGTTATTCTTCAGCTCAGCCAGTAGTATCCCGGATGCTTT
CTGCTTCACTTTCCATCTCACCAGTTCAGGCTTCATCATCATGTCTCTGAAGACAGTGGCAGTGATCGCC
CTGCACCGGCTCCGGATGGTGTTGGGGAAACAGCCTAATCGCACGGCCTCCTTTCCCTGCACCGTACTCC
TCACCCTGCTTCTCTGGGCCACCAGTTTCACCCTTGCCACCTTGGCTACCTTGAAAACCAGCAAGTCCCA
CCTCTGTCTTCCCATGTCCAGTCTGATTGCTGGAAAAGGGAAAGCCATTTTGTCTCTCTATGTGGTCGAC
TTCACCTTCTGTGTTGCTGTGGTCTCTGTCTCTTACATCATGATTGCTCAGACCCTGCGGAAGAACGCTC
AAGTCAGAAAGTGCCCCCCTGTAATCACAGTCGATGCTTCCAGACCACAGCCTTTCATGGGGGTCCCTGT
GCAGGGAGGTGGAGATCCCATCCAGTGTGCCATGCCGGCTCTGTATAGGAACCAGAATTACAACAAACTG
CAGCACGTTCAGACCCGTGGATATACCAAGAGTCCCAACCAACTGGTCACCCCTGCAGCAAGCCGACTCC
AGCTCGTATCAGCCATCAACCTCTCCACTGCCAAGGATTCCAAAGCCGTGGTCACCTGTGTGATCATTGT
GCTGTCAGTCCTGGTGTGCTGTCTTCCACTGGGGATTTCCTTGGTACAGGTGGTTCTCTCCAGCAATGGG
AGCTTCATTCTTTACCAGTTTGAATTGTTTGGATTTACTCTTATATTTTTCAAGTCAGGATTAAACCCTT
TTATATATTCTCGGAACAGTGCAGGGCTGAGAAGGAAAGTGCTCTGGTGCCTCCAATACATAGGCCTGGG
TTTTTTCTGCTGCAAACAAAAGACTCGACTTCGAGCCATGGGAAAAGGGAACCTCGAAGTCAACAGAAAC
AAATCCTCCCATCATGAAACAAACTCTGCCTACATGTTATCTCCAAAGCCACAGAAGAAATTTGTGGACC
AGGCTTGTGGCCCAAGTCATTCAAAAGAAAGTATGGTGAGTCCCAAGATCTCTGCTGGACATCAACACTG
TGGTCAGAGCAGCTCGACCCCCATCAACACTCGGATTGAACCTTACTACAGCATCTATAACAGCAGCCCT
TCCCAGGAGGAGAGCAGCCCATGTAACTTACAGCCAGTAAACTCTTTTGGATTTGCCAATTCATATATTG
CCATGCATTATCACACCACTAATGACTTAGTGCAGGAATATGACAGCACTTCAGCCAAGCAGATTCCAGT
CCCCTCCGTTTAA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_006794 unedited
TTCGAAATTTGTATACGACTCACTATAGGGCGGCCCGCGAATTCGCACGAGGCCGGGATG
CGCGGAGGCGGTGGCGATGGCGATGATGCCTCTAGTCCTGCATCATCCAGAGCGGCAGGC
GGAGCTGGGGTCCGGACTGCGAGATGGAGGAGGGGCGGCGCTGCGGCCACCCGGCAGGCT
TATCTGTCTTGGGCCTCTTTTGTCACATATTGCTCATCTGTGAGCTGAGGCCCTGACTCA
CTGAGTATTTTTGGGGAGCAGAAGAAGGAGACATTTCTCTCCGAAAATGAACTCAACAGG
CCACCTTCAGGATGCCCCCAATGCCACCTCGCTCCATGTGCCTCACTCACAGGAAGGAAA
CAGCACCTCTCTCCAGGAGGGTCTTCAGGATCTCATCCACACAGCCACCTTGGTGACCTG
TACTTTTCTACTGGCGGTCATCTTCTGCCTGGGTTCCTATGGCAACTTCATTGTCTTCTT
GTCCTTCTTCGATCCAGCCTTCAGGAAATTCAGAACCAACTTTGATTTCATGATCCTGAA
CCTGTCCTTCTGTGACCTCTTCATTTGTGGAGTGACAGCCCCCATGTTCACCTTTGTGTT
ATTCTTCAGCTCAGCCAGTAGTATCCCGGATGCTTTCTGCTTCACTTTCCATCTCACCAG
TTCAGGCTTCATCATCATGTCTCTGAAGACAGTGGCAGTGATCGCCCTGCACCGGCTCCG
GATGGTGTTGGGGAAACAGCCTAATCGCACGGCCTNNCTTTCCTGCACCGTACTCCTCAC
CCTGCTTCTCTGGGCCACCAGTTTCACCCTTGCCACCTTGGNCTACCTTGAAACCAGNCA
GTCCCACCTCTGTCTTCCATGTNCAGTCTGATTGCTGGAAAAGGGAAGCCATTTTGTCTC
TCTATGTGGNCGACTTCACTTNCTGTGTGCTGAGGGCTCTGTCTCT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_006794 unedited
CCCCCCAATAGTGTGNACCGCGGNCCGCTATTTTAGGATCGAGTTTTTTTTTTTTTTTTT
TTTAAAAAATCTAAAACTTTCACATCAAATCTTAAGATGTCAACAAACTACAAAGCAAAT
CAACAGATACTGACACATCAGATGAAAGAAAACCATAACTGCCAACTTTTCAGTTGAATC
TTGTAGGTTTTGATCCGCCACTGATCTCAAGTTAGAATAAAGTCCATTACTATCAGAAAC
AAAAACTGTTTACATAAGAGCCTATAGCCTCCATGACTTTAAACGGAGGGGACTGGAATC
TGCTTGGCTGAAGTGCTGTCATATTCCTGCACTAAGTCATTAGTGGTGTGATAATGCATG
GCAATATATGAATTGGCAAATCCAAAAGAGTTTACTGGCTGTAAGTTACATGGGCTGCTC
TCCTCCTGGGAAGGGCTGCTGTTATAGATGCTGTAGTAAGGTTCAATCCGAGTGTTGATG
GGGGTCGAGCTGCTCTGACCACAGTGTTGATGTCCAGCAGAGATCTTGGGACTCACCATA
CTTTCTTTTGAATGACTTGGGCCACAAGCCTGGTCCACAAATTTCTTCTGTGGCTTTGGA
GATAACATGTAGGCAGAGTTTGTTTCATGATGGGAGGATTTGTTTCTGTTGACTTCGAGG
TTCCCTTTTCCCATGGCTCGAAGTCGAGTCTTTTGTTTGCAGCAGAAAAAACCCAGGCCT
ATGTATTGGAGGCACCAGAGCACTTTCCTTCTCAGCCCTGCACTGTTCCGAGAAATATAA
CAGGGTTTAATCCTGACTTGAAAATATAAGAGTAAATCCTAACATTCAAACTGGTTAAGA
ATGAAGCTCTCATTGCTGGAGAGAACCACCTGTACCAGGGAAATTCCAGTGGAGCCAGCA
CACCAGTACTGACAGC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_006794
ORF Size 1623 bp
Insert Size 2250
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_006794.1, NP_006785
RefSeq Size 2054
RefSeq ORF 1623
Locus ID 10936
Cytogenetics 2p16.2
Domains 7tm_1
Protein Families GPCR, Transmembrane, Druggable Genome
Gene Summary GPR75 is a member of the G protein-coupled receptor family. GPRs are cell surface receptors that activate guanine-nucleotide binding proteins upon the binding of a ligand.[supplied by OMIM, Jul 2002]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.