KDELR2 (NM_006854) Human Untagged Clone

SKU
SC115813
KDELR2 (untagged)-Human KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 (KDELR2), transcript variant 1
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol KDELR2
Synonyms ELP-1; ELP1; ERD2.2; OI21
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC115813 sequence for NM_006854 edited (data generated by NextGen Sequencing)
ATGAACATTTTCCGGCTGACTGGGGACCTGTCCCACCTGGCGGCCATCGTCATCCTGCTG
CTGAAGATCTGGAAGACGCGCTCCTGCGCCGGTATTTCTGGGAAAAGCCAGCTTCTGTTT
GCACTGGTCTTCACAACTCGTTACCTGGATCTTTTTACTTCATTTATTTCATTGTATAAC
ACATCTATGAAGGTTATCTACCTTGCCTGCTCCTATGCCACAGTGTACCTGATCTACCTG
AAATTTAAGGCAACCTACGATGGAAATCATGATACCTTCCGAGTGGAGTTTCTGGTGGTC
CCTGTGGGAGGCCTCTCATTTTTAGTTAATCACGATTTCTCTCCTCTTGAGATCCTCTGG
ACCTTCTCCATCTACCTGGAGTCCGTGGCTATCCTTCCGCAGCTGTTTATGATCAGCAAG
ACTGGGGAGGCCGAGACCATCACCACCCACTACCTGTTCTTCCTGGGCCTCTATCGTGCT
TTGTATCTTGTCAACTGGATCTGGCGCTTCTACTTTGAGGGCTTCTTTGACCTCATTGCT
GTGGTGGCCGGCGTAGTCCAGACCATCCTATACTGTGACTTCTTCTACTTGTACATTACA
AAAGTACTCAAGGGAAAGAAGCTCAGTTTGCCAGCATAA

Clone variation with respect to NM_006854.3
405 a=>g
5' Read Nucleotide Sequence
>OriGene 5' read for NM_006854 unedited
TTGTATACGACTCACTATAGGCGGCCGCGAATTCGCACGAGCTCAGGGGCCGCCGCCTCC
TGAGCCGCCCAGCCCCGGGGCCGCCGCGCTGCGCCGACCGCCACCGCCGCCGCCGCCATG
AACATTTTCCGGCTGACTGGGGACCTGTCCCACCTGGCGGCCATCGTCATCCTGCTGCTG
AAGATCTGGAAGACGCGCTCCTGCGCCGGTATTTCTGGGAAAAGCCAGCTTCTGTTTGCA
CTGGTCTTCACAACTCGTTACCTGGATCTTTTTACTTCATTTATTTCATTGTATAACACA
TCTATGAAGGTTATCTACCTTGCCTGCTCCTATGCCACAGTGTACCTGATCTACCTGAAA
TTTAAGGCAACCTACGATGGAAATCATGATACCTTCCGAGTGGAGTTTCTGGTGGTCCCT
GTGGGAGGCCTCTCATTTTTAGTTAATCACGATTTCTCTCCTCTTGAGATCCTCTGGACC
TTCTCCATCTACCTGGAGTCCGTGGCTATCCTTCCGCAGCTGTTTATGATCAGCAAGACT
GGGGAGGCCGAGACCATCACCACCCACTACCTGTTCTTCCTGNGCCTCTATCGTGCTTTG
TATCTTGTCAACTGGATCTGGCGCTTCTACTTTGAGGGCTTCTTTGACCTCATTGCTGTG
GTGGCCGGCGTANTCCAGACCATCCTATACTGTGACTTCTTCTACTTGTACATTACANAA
GTACTCAAGGGAAGAAGCTCAGTTTGCCAGCATAAGTGCCAAAGACATCACCAGCATCTG
TCCTTCAGGNTGCTCGNACAGAATTCTTACACAGCANAGGCATAGATGCTGTACGNANAT
CAGAACTAACTCTTTTGTGCAGATGTCATAGTGGCTCTGTAAAACGCGAGGAAAGAGCC
Restriction Sites NotI-NotI
ACCN NM_006854
Insert Size 2190 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006854.2, NP_006845.1
RefSeq Size 1153 bp
RefSeq ORF 639 bp
Locus ID 11014
UniProt ID P33947
Cytogenetics 7p22.1
Domains ER_lumen_recept
Protein Families Druggable Genome, Transmembrane
Protein Pathways Vibrio cholerae infection
Summary Retention of resident soluble proteins in the lumen of the endoplasmic reticulum (ER) is achieved in both yeast and animal cells by their continual retrieval from the cis-Golgi, or a pre-Golgi compartment. Sorting of these proteins is dependent on a C-terminal tetrapeptide signal, usually lys-asp-glu-leu (KDEL) in animal cells, and his-asp-glu-leu (HDEL) in S. cerevisiae. This process is mediated by a receptor that recognizes, and binds the tetrapeptide-containing protein, and returns it to the ER. In yeast, the sorting receptor encoded by a single gene, ERD2, is a seven-transmembrane protein. Unlike yeast, several human homologs of the ERD2 gene, constituting the KDEL receptor gene family, have been described. KDELR2 was the second member of the family to be identified, and it encodes a protein which is 83% identical to the KDELR1 gene product. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
Write Your Own Review
You're reviewing:KDELR2 (NM_006854) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200007 KDELR2 (Myc-DDK-tagged)-Human KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 (KDELR2), transcript variant 1 10 ug
$300.00
RC200007L1 Lenti ORF clone of Human KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 (KDELR2), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC200007L2 Lenti ORF clone of Human KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 (KDELR2), transcript variant 1, mGFP tagged 10 ug
$600.00
RC200007L3 Lenti ORF clone of Human KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 (KDELR2), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC200007L4 Lenti ORF clone of Human KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 (KDELR2), transcript variant 1, mGFP tagged 10 ug
$600.00
RG200007 KDELR2 (tGFP-tagged) - Human KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 (KDELR2), transcript variant 1 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.