RIT1 (NM_006912) Human Untagged Clone

CAT#: SC115778

Reviews ()
Write a review

RIT1 (untagged)-Human Ras-like without CAAX 1 (RIT1)



Reconstitution Protocol

USD 450.00

In Stock*

Size
    • 10 ug

Product images

Other products for "RIT1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RIT1
Synonyms NS8; RIBB; RIT; ROC1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_006912 edited
ATGGATTCTGGAACTCGCCCAGTTGGTAGCTGCTGTAGCAGCCCCGCTGGGCTCTCACGG
GAGTACAAACTAGTGATGCTGGGTGCTGGTGGTGTAGGGAAGAGTGCCATGACCATGCAG
TTCATCAGCCACCGATTCCCAGAAGATCATGATCCCACCATTGAAGATGCTTATAAGATC
AGGATCCGTATTGATGATGAGCCTGCCAATCTGGACATTTTGGATACAGCTGGACAGGCA
GAGTTTACAGCCATGCGGGACCAGTATATGAGGGCAGGAGAAGGGTTTATCATCTGTTAC
TCTATCACGGATCGTCGAAGTTTCCATGAAGTTCGTGAGTTTAAACAGCTTATTTATCGA
GTCCGACGTACTGACGATACACCTGTGGTTCTTGTGGGAAACAAGTCAGACCTCAAACAG
CTAAGACAGGTCACCAAGGAAGAAGGATTGGCCTTGGCCCGAGAATTCAGCTGTCCCTTT
TTTGAGACATCTGCTGCATACCGCTACTATATTGATGATGTTTTCCATGCCCTTGTACGG
GAGATACGTAGGAAAGAAAAGGAGGCAGTACTGGCCATGGAGAAAAAATCTAAGCCCAAA
AACAGTGTATGGAAGAGGCTAAAATCACCATTCCGGAAGAAGAAAGATTCAGTAACTTGA
>OriGene 5' read for NM_006912 unedited
TTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGGGAAGACGAAGTG
CGTGACCCGACCGGCTGTGGTGTTCCAGTCCCCACTGACCAGTAGGAGCAGCAGGGCGTC
GGCTTGTGAGGTGGCTTTTCCTCGGGGCAACCCAGGAAGGCCCCAAGAGGACAATGGATT
CTGGAACTCGCCCAGTTGGTAGCTGCTGTAGCAGCCCCGCTGGGCTCTCACGGGAGTACA
AACTAGTGATGCTGGGTGCTGGTGGTGTAGGGAAGAGTGCCATGACCATGCAGTTCATCA
GCCACCGATTCCCAGAAGATCATGATCCCACCATTGAAGATGCTTATAAGATCAGGATCC
GTATTGATGATGAGCCTGCCAATCTGGACATTTTGGATACAGCTGGACAGGCAGAGTTTA
CAGCCATGCGGGACCAGTATATGAGGGCAGGAGAAGGGTTTATCATCTGTTACTCTATCA
CGGATCGTCGAAGTTTCCATGAAGTTCGTGAGTTTAAACAGCTTATTTATCGAGTCCGAC
GTACTGACGATACACCTGTGGTTCTTGTGGGAAACAAGTCAGACCTCAAACAGCTAAGAC
AGGTCACCAAGGAAGAAGGATTGGCCTTGGCCCGAGAATTCAGCTGTCCCTTTTTTGAGA
CATCTGCTGCATACCGCTACTATATTGATGATGTTTTCCATGCCCTTGTACGGGAGATAC
GTANGAAAGAAAAGGAGCAGTACTGGCCATGGAGAANAAATCTAAGCCAAAACAGTGTAT
GGAAGAAGCTAANATCACCATTCCGGAAGAAGAAAGATTCAGTAACTTGAAGAGAGATGT
GAAGTGNTTATCTGTGAACTGCAGTGCTGTATCAAAGCAGTCCAGTAACCTGCAGTACTG
AGTATGGTGCT
Restriction Sites NotI-NotI     
ACCN NM_006912
Insert Size 2640 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_006912.3, NP_008843.1
RefSeq Size 1104 bp
RefSeq ORF 660 bp
Locus ID 6016
UniProt ID Q92963
Cytogenetics 1q22
Domains ras, RAN, RAS, RHO, RAB
Gene Summary This gene encodes a member of a subfamily of Ras-related GTPases. The encoded protein is involved in regulating p38 MAPK-dependent signaling cascades related to cellular stress. This protein also cooperates with nerve growth factor to promote neuronal development and regeneration. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
Transcript Variant: This variant (2) differs in the 5' UTR and has multiple coding region differences. These difference cause translation at a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.