ABCB8 (NM_007188) Human Untagged Clone

CAT#: SC115672

ABCB8 (untagged)-Human ATP-binding cassette, sub-family B (MDR/TAP), member 8 (ABCB8), nuclear gene encoding mitochondrial protein

USD 721


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name ABCB8 (NM_007188) Human Untagged Clone
Symbol ABCB8
Synonyms EST328128; M-ABC1; MABC1
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC115672 sequence for NM_007188 edited (data generated by NextGen Sequencing)
ATGCTGGTGCATTTATTTCGGGTCGGGATTCGGGGTGGCCCATTCCCAGGCAGGCTGCTA
CCGCCCCTCCGCTTCCAGACATTCTCAGCTGTCAGGTACTCTGATGGCTACCGCAGCTCC
TCCCTCCTCCGGGCCGTGGCCCACCTGCGGTCCCAGCTCTGGGCCCACCTCCCTCGAGCC
CCCCTAGCTCCCAGATGGAGCCCCTCTGCCTGGTGCTGGGTTGGGGGAGCCCTGCTAGGC
CCCATGGTACTGAGTAAGCATCCCCACCTCTGCCTTGTGGCCCTGTGTGAGGCAGAAGAG
GCCCCTCCTGCCAGCTCCACACCCCATGTCGTGGGGTCTCGCTTTAACTGGAAGCTCTTC
TGGCAGTTTCTGCACCCCCACCTGCTGGTCCTGGGGGTAGCCGTCGTGCTGGCCTTGGGT
GCGGCACTCGTGAATGTACAGATCCCCCTGCTCCTGGGCCAGCTGGTAGAGGTCGTGGCC
AAGTACACAAGGGACCACGTAGGGAGTTTCATGACTGAGTCCCAGAATCTCAGCACCCAC
CTGCTTATCCTCTATGGTGTCCAGGGACTGCTGACCTTCGGGTACCTGGTGCTGCTGTCC
CACGTTGGCGAGCGCATGGCTGTGGACATGCGGAGGGCCCTCTTCAGCTCCCTGCTCCGA
CAAGACATCACCTTCTTTGACGCCAATAAGACAGGGCAGCTGGTGAGCCGCTTGACAACT
GACGTGCAGGAGTTTAAGTCATCCTTCAAGCTTGTCATCTCCCAGGGGCTGCGAAGCTGC
ACCCAGGTGGCAGGCTGCCTGGTGTCCCTGTCCATGCTGTCGACACGCCTCACGCTGCTG
CTGATGGTGGCCACACCAGCCCTGATGGGAGTGGGCACCCTGATGGGCTCAGGCCTCCGA
AAATTGTCTCGCCAGTGTCAGGAGCAGATCGCCAGGGCAATGGGCGTAGCAGACGAGGCC
CTGGGCAATGTGCGGACTGTGCGAGCCTTCGCCATGGAGCAACGGGAAGAGGAGCGCTAT
GGGGCAGAGCTGGAAGCCTGCCGCTGCCGGGCAGAGGAGCTGGGCCGCGGCATCGCCTTG
TTCCAAGGGCTTTCCAACATCGCCTTCAACTGCATGGTCTTGGGTACCCTATTTATTGGG
GGCTCCCTTGTGGCCGGACAGCAGCTGACAGGGGGAGACCTCATGTCCTTCCTGGTGGCC
TCCCAGACAGTGCAAAGGTCCATGGCCAACCTCTCTGTCCTGTTTGGGCAGGTGGTCCGG
GGGCTGAGTGCAGGTGCCCGGGTCTTTGAGTACATGGCCCTGAACCCCTGCATCCCACTG
TCTGGGGGCTGCTGCGTCCCCAAAGAGCAGCTGCGTGGCTCCGTTACATTTCAGAACGTC
TGCTTCAGCTACCCCTGCCGCCCCGGCTTCGAGGTGCTGAAAGACTTCACCCTGACGCTG
CCCCCTGGCAAGATCGTGGCCCTCGTGGGCCAGTCTGGCGGAGGAAAGACCACCGTGGCT
TCCCTGCTGGAGCGCTTCTACGACCCCACGGCAGGCGTGGTGATGCTGGATGGGCGGGAC
CTGCGCACCCTTGACCCCTCCTGGCTCCGGGGCCAGGTTGTCGGCTTCATCAGCCAGGAG
CCCGTCCTGTTTGGGACGACCATCATGGAAAACATCCGCTTTGGGAAGCTGGAAGCTTCC
GATGAAGAGGTGTACACAGCCGCCCGGGAAGCGAATGCTCACGAGTTCATCACCAGCTTC
CCCGAGGGCTACAACACGGTCGTCGGTGAACGGGGCACTACCCTGTCTGGGGGCCAGAAG
CAGCGCCTGGCCATCGCCCGAGCCCTTATCAAGCAGCCCACGGTGCTGATACTGGATGAA
GCTACCAGCGCGCTGGATGCAGAGTCCGAGCGGGTTGTACAGGAGGCCCTGGACCGGGCC
AGTGCAGGCCGCACGGTGCTGGTAATTGCCCACCGGCTCAGCACTGTCCGTGGGGCCCAC
TGCATTGTCGTCATGGCCGATGGCCGTGTCTGGGAGGCTGGGACACATGAAGAGCTCCTG
AAGAAAGGCGGGCTATACGCCGAGCTCATCCGGAGGCAGGCCCTGGATGCCCCGAGGACA
GCGGCCCCACCGCCCAAAAAGCCAGAAGGCCCCAGGAGCCACCAGCACAAGTCCTGA

Clone variation with respect to NM_007188.3
984 t=>a
5' Read Nucleotide Sequence
>OriGene 5' read for NM_007188 unedited
NGGGTTCAAATTTGTATACGACTCATATAGGCGGCCGCGNAATTCGCACGAGGCCAACAT
AGAGCCCTCAGTGGGATGAGGGTGAAACTGCTATTGCCGGCGGCTCCTGTTTTACCGCGT
CAGCATGCTGGTGCATTTATTTCGGGTCGGGATTCGGGGTGGCCCATTCCCAGGCAGGCT
GCTACCGCCCCTCCGCTTCCAGACATTCTCAGCTGTCAGGTACTCTGATGGCTACCGCAG
CTCCTCCCTCCTCCGGGCCGTGGCCCACCTGCGGTCCCAGCTCTGGGCCCACCTCCCTCG
AGCCCCCCTAGCTCCCAGATGGAGCCCCTCTGCCTGGTGCTGGGTTGGGGGAGCCCTGCT
AGGCCCCATGGTACTGAGTAAGCATCCCCACCTCTGCCTTGTGGCCCTGTGTGAGGCAGA
AGAGGCCCCTCCTGCCAGCTCCACACCCCATGTCGTGGGGTCTCGCTTTAACTGGAAGCT
CTTCTGGCAGTTTCTGCACCCCCACCTGCTGGTCCTGGGGGTAGCCGTCGTGCTGGCCTT
GGGTGCGGCACTCGTGAATGTACAGATCCCCCTGCTCCTGGGCCAGCTGGTAGAGGTCGT
GGCCAAGTACACAAGGGACCACGTAGGGAGTTTCATGACTGAGTCCCAGAATCTCAGCAC
CCACCTGCTTATCCTCTATGGTGTCCAGGGACTGCTGACCTTCGGGTACCTGGTGCTGCT
GTCCCACGTTGGCGAGCGCATGGCTGTGGACATGCGGAGGGCCCTCTTCAGCTCCCTGCT
CCGACNAGACATCACCTTCTTTGACGCCAATAAGACAGGGCAGCTGGTGAGCCGCTTGAC
AACTGACGTGCANGAGTTTTAAGTCATCCTTCAAGCTTGTCATCTCCCAGGGNCTGCNGA
ACTGCACCCAGNT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_007188 unedited
CACGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTCTGGTGGGAGGGTAGGCAGCCGG
CAGGACTGGGGAGGGGAGGGAGGGATTGGCCTCCCCTGCCAGCTGCTCGGTCCCGGCTTT
ATTGTGAGCAGGAGCAGTCGCATCGACTCTACACATGCTGAGTCCTCCTGGGGGCTCATT
TCTTATTAGGCTCTTCCAGGCTGAGTCCCATCCCTAACACTGATGCTTGGTAGTGACCAT
CCTTAGGGGGTCCTTTTCATGACTTGTGCTGCTGGTTACTGGGGTCTTCTGGTTTTTCGG
CTCGGTGGGGTTCGATGTCCTTGGGGTATTCTGGGCCTGTCTCCGGATGATCCCGACGCA
CATCCCGCCTCTCTTCAGGCAGCTCCTTTTGTTGCTTTATCTCTTTCACTCGGTCTTTGT
CTTTGTAAACATTGATTTTGGTTTTTTTCGCTCCCTGCTTGTATTCTCTGGTTACTTCAT
TCTTCACTCCATCGGTTCCGCTCTGCTACTGTATCTTGTTCTTTCGCTTATATTTCCCTT
CTCTTTTCTCTTCTCCTCTCTGGTTTCTTCTTACTTACCATTCCTCCTCTCTCTCCTCCC
ACTGGCCTCTTCTTCCGCTATTTTTCTCCCTCCTCCCTCCTCCTTTTGTTTCTCCCCTTC
TCTTCTTTCTTCCCCACATCCTACTACTTCGCACCCATCTCTTCGTGTTTTTTTCAGTTC
TTTCCTCCCCTCTTCTCTCTTTCCCCCCTCTCCTCCCTTTTCCTCTCTCTCTGTTTTCTT
TTATTTCCTTTCTCATTTACTTACTGCTTCTCCTCACTTTCGATATCATTTACTTTTCTA
CTCCCCCACTTTCTCTGTCTTATCTACTCTCCTTCCTTCCTACTTACTTGTTACCTCTTT
ACTTCCCCTTTCTTCCCCTTCACCCCTTCTTCTTTCTCTCTCCTACATTCTCTCTCTCCT
CTCACTGCTCCTTTTTTAACTCTCTCTCTCTTTTCCCCTCTTTTTTTTCTCTTCTTCTTT
ATACCACGCCCCTCTATCNCCACTCACTCTCCTTCTACGCAN
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_007188
ORF Size 2157 bp
Insert Size 2560
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_007188.2, NP_009119
RefSeq Size 2439
RefSeq ORF 2157
Locus ID 11194
Cytogenetics 7q36.1
Domains ABC_membrane, ABC_tran, AAA
Protein Families Transmembrane, Druggable Genome
Protein Pathways ABC transporters
Gene Summary This nuclear gene encodes a multi-pass membrane protein that is targeted to the mitochondrial inner membrane. The encoded protein is an ATP-dependent transporter that may mediate the passage of organic and inorganic molecules out of the mitochondria. Loss of function of the related gene in mouse results in a disruption of iron homeostasis between the mitochondria and cytosol. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. The encoded isoform (b) is shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.