SAP62(SF3A2) (NM_007165) Human Untagged Clone

CAT#: SC115656

SF3A2 (untagged)-Human splicing factor 3a, subunit 2, 66kDa (SF3A2)

  View "NM_007165" in other vectors (6)

USD 300.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name SAP62(SF3A2) (NM_007165) Human Untagged Clone
Symbol SF3A2
Synonyms PRP11; PRPF11; SAP62; SF3a66
Vector pCMV6-XL6
Sequence Data
>OriGene ORF within SC115656 sequence for NM_007165 edited (data generated by NextGen Sequencing)
ATGGACTTCCAGCATCGCCCCGGGGGCAAGACCGGGAGCGGGGGCGTGGCCTCCTCCTCC
GAGAGCAACCGTGACCGCAGGGAGCGCCTCCGGCAGCTGGCCCTGGAGACCATCGACATC
AACAAGGACCCGTACTTCATGAAGAACCACCTGGGCTCCTATGAATGCAAACTCTGCCTG
ACACTTCACAACAATGAGGGGAGCTACCTGGCACATACGCAGGGGAAGAAGCACCAGACC
AACCTGGCCCGGCGAGCAGCCAAGGAGGCCAAGGAGGCCCCTGCCCAGCCCGCGCCTGAG
AAGGTCAAGGTGGAGGTGAAGAAGTTTGTGAAGATCGGCCGCCCGGGCTACAAAGTGACC
AAGCAGAGAGACTCGGAGATGGGCCAGCAGAGCCTCCTCTTCCAGATTGACTACCCTGAG
ATCGCCGAGGGCATCATGCCACGTCACCGCTTCATGTCTGCGTACGAGCAGAGGATCGAG
CCTCCGGACCGGCGCTGGCAGTACCTGCTCATGGCCGCCGAGCCCTACGAGACCATTGCC
TTCAAGGTGCCGAGCAGAGAGATCGACAAGGCGGAGGGCAAGTTCTGGACACACTGGAAC
CGGGAGACCAAGCAGTTCTTCCTCCAGTTCCACTTTAAGATGGAGAAGCCCCCGGCTCCA
CCCAGCCTCCCTGCTGGCCCCCCTGGGGTGAAGCGGCCTCCACCCCCGCTGATGAACGGT
CTGCCCCCTCGGCCACCGCTGCCTGAGTCTTTGCCACCGCCCCCGCCAGGAGGCCTGCCT
CTGCCACCCATGCCCCCCACAGGGCCTGCGCCCTCAGGGCCCCCGGGACCACCCCAGCTA
CCCCCGCCAGCTCCAGGGGTCCACCCCCCGGCCCCAGTGGTGCATCCCCCTGCATCTGGG
GTCCATCCCCCAGCTCCTGGCGTCCACCCCCCAGCTCCTGGCGTCCATCCCCCAGCCCCT
GGGGTCCACCCACCAACCTCTGGGGTCCACCCCCCAGCTCCTGGAGTCCACCCTCCAGCC
CCCGGGGTTCACCCACCAGCCCCCGGAGTCCACCCACCAGCCCCTGGGGTTCACCCACCA
GCCCCAGGGGTCCATCCTCCCCCATCAGCGGGGGTTCACCCCCAGGCCCCGGGGGTGCAC
CCAGCAGCCCCCGCCGTTCACCCTCAGGCCCCAGGGGTGCACCCACCAGCCCCAGGGATG
CACCCTCAGGCCCCGGGGGTCCACCCCCAACCTCCCGGGGTCCATCCGTCGGCTCCTGGG
GTCCACCCTCAGCCTCCGGGAGTTCACCCCTCAAATCCTGGGGTGCACCCCCCAACTCCC
ATGCCCCCAATGCTGAGGCCCCCACTTCCCTCCGAAGGCCCAGGGAACATACCTCCCCCT
CCCCCAACCAACTGA

Clone variation with respect to NM_007165.4
>OriGene 5' read for NM_007165 unedited
TATAACACCCGCCCGTTGNCGCAAAGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAA
GCAGAGCTCATTTAGGTGACACTATAGAATACAAGCTACTTGTTCTTTTTGCAGCGGCCG
CGAATTCGGCACGAGGCCGCCGTTCGCCAAACGAAGTCGTGGAGGTGGCGAAACGAGGAG
GAGATAACGCGGCCTTGGGCTCTGGTGTCTCCCAGTCTGCTAAAGCCCTAAGGCCATCAC
CATGGACTTCCAGCATCGCCCCGGGGGCAAGACCGGGAGCGGGGGCGTGGCCTCCTCCTC
CGAGAGCAACCGTGACCGCAGGGAGCGCCTCCGGCAGCTGGCCCTGGAGACCATCGACAT
CAACAAGGACCCGTACTTCATGAAGAACCACCTGGGCTCCTATGAATGCAAACTCTGCCT
GACACTTCACAACAATGAGGGGAGCTACCTGGCACATACGCAGGGGAAGAAGCACCAGAC
CAACCTGGCCCGGCGAGCAGCCAAGGAGGCCAAGGAGGCCCCTGCCCAGCCCGCGCCTGA
GAAGGTCAAGGTGGAGGTGAAGAAGTTTGTGAAGATCGGCCGCCCGGGCTACAAAGTGAC
CAAGCAGAGAGACTCGGAGATGGGCCAGCAGAGCCTCCTCTTCCAGATTGACTACCCTGA
GATCGCCGAGGGCATCATGCCACGTCACCGCTTCATGTCTGCGTACGAGCAGAGGATCGA
GCCTCCGGACCGGCGCTGGCAGTACCTGCTCATGGCCGCCGAGCCCTACGAGACCATTGC
CTTNCAGGTGCCGAGCAGAGAGATCGANCAGGCGGAGGGGCAGTTCTGGCACACTGGACA
CGGGGACCCNAGCAGNTCTTNCTCCAGTTCACTTTAAGAAAGGAAGAAAGCCCCGGGTCC
ACCCAGNCTNCCTGCTGTCCCCCTGTGGGTGGAACCGGCCTCCCCN
>OriGene 3' read for NM_007165 unedited
NCCCGGAATTCGATGTACCGCGCCGCAATCTANATCGAGTTTTTTTTTTTTTTTTTTGGG
GGAGGCTGTTTAATGAGCGGGGGGCAGTACAAAAGACAGCCTTCTCTCAGTGGGAAAAGG
CAAGAGCACCTGGCGCTGGGCTTGCTGGGGGAGGGAGCAGCTTCTCAGTTGGTTGGGGGA
GGGGGAGGTATGTTCCCTGGGCCTTCGGAGGGAAGTGGGGGCCTCAGCATTGGGGGCATG
GGAGTTGGGGGGTGCACCCCAGGATTTGAGGGGTGAACTCCCGGAGGCTGAGGGTGGACC
CCAGGAGCCGACGGATGGACCCCGGGAGGTTGGGGGTGGACCCCCGGGGCCTGAGGGTGC
ATCCCTGGGGCTGGTGGGTGCACCCCTGGGGCCTGAGGGTGAACGGCGGGGGCTGCTGGG
TGCACCCCCGGGGCCTGGGGGTGAACCCCCGCTGATGGGGGAGGATGGACCCCTGGGGCT
GGTGGGTGAACCCCAGGGGCTGGTGGGTGGACTCCGGGGGCTGGTGGGTGAACCCCGGGG
GCTGGAGGGTGGACTCCAGGAGCTGGGGGGTGGACCCCACAAGTTGGTGGGGGGACCCCA
GGGGGCCTGGGGATGGACACCCAGAACTGGGGGGTTGGACCCCAGAAGCTTGGGGATTGG
ACCCCCGATTCCAGGGGATGCACCCCTGGGGCCCGGGGGGGGGCCCCCTGGAAATTGGCG
GGGGTTGCTGGGGTGGGCCCCGGGGCCCCTGGGGCTCCAGCCCTTTTGGGGGCATTGGTT
GGCAAAAACGGACTCCCTTCGCGGGCGTGGGGAAAAACTCCGCCTCGGTTGCCCGTGGGG
GCCCACCGTATTCATCCGGGGGGGGGGACCCCTCCTCCCCGGGTGGCCACC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_007165
ORF Size 1395 bp
Insert Size 1750
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_007165.4, NP_009096
RefSeq Size 1678
RefSeq ORF 1395
Locus ID 8175
Cytogenetics 19p13.3
Domains ZnF_U1
Protein Pathways Spliceosome
Gene Summary This gene encodes subunit 2 of the splicing factor 3a protein complex. The splicing factor 3a heterotrimer includes subunits 1, 2 and 3 and is necessary for the in vitro conversion of 15S U2 snRNP into an active 17S particle that performs pre-mRNA splicing. Subunit 2 interacts with subunit 1 through its amino-terminus while the single zinc finger domain of subunit 2 plays a role in its binding to the 15S U2 snRNP. Subunit 2 may also function independently of its RNA splicing function as a microtubule-binding protein. [provided by RefSeq, Jul 2008].

Other Versions

Other products for "SF3A2"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
10 percent off protein banner ad
68 Mouse Clones
20%off selected tag antibodies