Monoacylglycerol Lipase(MGLL) (NM_007283) Human Untagged Clone

CAT#: SC115603

MGLL (untagged)-Human monoglyceride lipase (MGLL), transcript variant 1

USD 505


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Monoacylglycerol Lipase(MGLL) (NM_007283) Human Untagged Clone
Symbol MGLL
Synonyms HU-K5; HUK5; MAGL; MGL
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC115603 sequence for NM_007283 edited (data generated by NextGen Sequencing)
ATGGAAACAGGACCTGAAGACCCTTCCAGCATGCCAGAGGAAAGTTCCCCCAGGCGGACC
CCGCAGAGCATTCCCTACCAGGACCTCCCTCACCTGGTCAATGCAGACGGACAGTACCTC
TTCTGCAGGTACTGGAAACCCACAGGCACACCCAAGGCCCTCATCTTTGTGTCCCATGGA
GCCGGAGAGCACAGTGGCCGCTATGAAGAGCTGGCTCGGATGCTGATGGGGCTGGACCTG
CTGGTGTTCGCCCACGACCATGTTGGCCACGGACAGAGCGAAGGGGAGAGGATGGTAGTG
TCTGACTTCCACGTTTTCGTCAGGGATGTGTTGCAGCATGTGGATTCCATGCAGAAAGAC
TACCCTGGGCTTCCTGTCTTCCTTCTGGGCCACTCCATGGGAGGCGCCATCGCCATCCTC
ACGGCCGCAGAGAGGCCGGGCCACTTCGCCGGCATGGTACTCATTTCGCCTCTGGTTCTT
GCCAATCCTGAATCTGCAACAACTTTCAAGGTCCTTGCTGCGAAAGTGCTCAACCTTGTG
CTGCCAAACTTGTCCCTCGGGCCCATCGACTCCAGCGTGCTCTCTCGGAATAAGACAGAG
GTCGACATTTATAACTCAGACCCCCTGATCTGCCGGGCAGGGCTGAAGGTGTGCTTCGGC
ATCCAACTGCTGAATGCCGTCTCACGGGTGGAGCGCGCCCTCCCCAAGCTGACTGTGCCC
TTCCTGCTGCTCCAGGGCTCTGCCGATCGCCTATGTGACAGCAAAGGGGCCTACCTGCTC
ATGGAGTTAGCCAAGAGCCAGGACAAGACTCTCAAGATTTATGAAGGTGCCTACCATGTT
CTCCACAAGGAGCTTCCTGAAGTCACCAACTCCGTCTTCCATGAAATAAACATGTGGGTC
TCTCAAAGGACAGCCACGGCAGGAACTGCGTCCCCACCCTGA

Clone variation with respect to NM_007283.5
5' Read Nucleotide Sequence
>OriGene 5' read for NM_007283 unedited
GGCGTGCANATTTGTATACGACTCACTATAGGCGGCCGCGAATTCGCACGAGGCCTCGTG
CCGAATTCGGCACGAGGGAGGGAACAGCCCGATTTGCCTGGTTCTGATTCTCCAGGCTGT
CGTGGTTGTGGAATGCAAACGCCAGCACATAATGGAAACAGGACCTGAAGACCCTTCCAG
CATGCCAGAGGAAAGTTCCCCCAGGCGGACCCCGCAGAGCATTCCCTACCAGGACCTCCC
TCACCTGGTCAATGCAGACGGACAGTACCTCTTCTGCAGGTACTGGAAACCCACAGGCAC
ACCCAAGGCCCTCATCTTTGTGTCCCATGGAGCCGGAGAGCACAGTGGCCGCTATGAAGA
GCTGGCTCGGATGCTGATGGGGCTGGACCTGCTGGTGTTCGCCCACGACCATGTTGGCCA
CGGACAGAGCGAAGGGGAGAGGATGGTAGTGTCTGACTTCCACGTTTTCGTCAGGGATGT
GTTGCAGCATGTGGATTCCATGCAGAAAGACTACCCTGGGCTTCCTGTCTTCCTTCTGGG
CCACTCCATGGGAGGCGCCATCGCCATCCTCACGGCCGCAGAGAGGCCGGGCCACTTCGC
CGGCATGGTACTCATTTCGCCTCTGGTTCTTGCCAATCCTGAATCTGCAACAACTTTCAA
GGTCCTTGCTGCGAAAGTGCTCAACCTTGTGCTGCCAAACTTGTCCCTCGGGCCCATCGA
CTCCAGCGTGCTCTCTCGGAATAAGACAGAGTCGACATTTATAACTCAGACCCCCTGATC
TGCCGGGCAGGGCTGAAGGTGTGCTTCGGCATTCAACTGCTGAATGCCGTCTCACGGGTG
GAGCGCGCCCTTCCCAAGCTGACTGTGCCCTTTCTGCTGCTCCAGGCCTTTGGCGATCGC
CTATGTGACAAGCAAGGGGCCTACCTG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_007283 unedited
TAGCTTGTCCGCGGCCGCAATCTANAGTCGAGTTTTTTTTTTTTTTTTTTGGCAAGCCAT
ATCTGAGAAGCCATCTCTGCCCTTCCCCTGCCTGCATCCCCCAGACCTGAGCCGGGCACC
GGCCAATGCATTCAGGGTGGGGACGCAGTTCCTGCCGTGGCTGTCCTTTGAGAGACCCAC
ATGTTTATTTCATGGAAGACGGAGTTGGTGACTTCAGGAAGCTCCTTGTGGAGAACATGG
TAGGCACCTTCATAAATCTTGAGAGTCTTGTCCTGGCTCTTGGCTAACTCCATGAGCAGG
TAGGCCCCTTTGCTGTCACATAGGCGATCGGCACAGCCCTGGAGCAGCAGGAAGGGCACA
GCCAGCTTGGGGAGGGCGCGCTCCACCCGTGAGACGGCATTCAGCAGTTGGATGCCGAAG
CACACCTTCAGCCCTGCCCGGCAGATCAGGGGGTCTGAGTTATAAATGTCGACCTCTGTC
TTATTCCGAGAGAGCACGCTGGAGTCGATGGGCCCGAGGGACAAGCTTGGCAGCACAAGG
TTGAGCACTTTCCCAGCAAGGACCTTGAAAGTTGTTGTAGATTTAGGATTGGCAAGAACC
AGAGGCGAAATGAGTACCATGCCCGGCGAAGTGGCCCGGCCTCTCTGCGGCCGTGAGGAT
GGCGATGGCGCCTCCCATGGAGTGGTTCATATAGAAGCCGGAAGCCCAGTGTATTCCTTT
TGCCTGGAATTCAATGCTGGAACAAAACCCTGAGAAAAAGGGCAGCCAGACCCTACCATT
CTCTTCCCCTTGGTCTGTCCGGTGTCATATTGTCTGGGGGCCAAACCCCGCCAGTCCCAC
CCCTCAGATTCCGACCAACTCTCTTAACGGCCACGGGCTTCCCGCTCATGGACAAAAAAA
GAAGCCCTTGGTGCGCCGGGGGCTCCCCACCCGCAAAAG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_007283
ORF Size 942 bp
Insert Size 1090
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_007283.5, NP_009214
RefSeq Size 4617
RefSeq ORF 942
Locus ID 11343
Cytogenetics 3q21.3
Domains abhydrolase
Protein Families Protease, Druggable Genome
Protein Pathways Glycerolipid metabolism, Metabolic pathways
Gene Summary This gene encodes a serine hydrolase of the AB hydrolase superfamily that catalyzes the conversion of monoacylglycerides to free fatty acids and glycerol. The encoded protein plays a critical role in several physiological processes including pain and nociperception through hydrolysis of the endocannabinoid 2-arachidonoylglycerol. Expression of this gene may play a role in cancer tumorigenesis and metastasis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012].
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations