NMDAR1(GRIN1) (NM_007327) Human Untagged Clone

CAT#: SC115601

GRIN1 (untagged)-Human glutamate receptor, ionotropic, N-methyl D-aspartate 1 (GRIN1), transcript variant NR1-3

USD 1,793.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name NMDAR1(GRIN1) (NM_007327) Human Untagged Clone
Symbol GRIN1
Synonyms GluN1; MRD8; NMD-R1; NMDA1; NMDAR1; NR1
Vector pCMV6-XL6
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC115601 sequence for NM_007327 edited (data generated by NextGen Sequencing)
ATGAGCACCATGCGCCTGCTGACGCTCGCCCTGCTGTTCTCCTGCTCCGTCGCCCGTGCC
GCGTGCGACCCCAAGATCGTCAACATTGGCGCGGTGCTGAGCACGCGGAAGCACGAGCAG
ATGTTCCGCGAGGCCGTGAACCAGGCCAACAAGCGGCACGGCTCCTGGAAGATTCAGCTC
AATGCCACCTCCGTCACGCACAAGCCCAACGCCATCCAGATGGCTCTGTCGGTGTGCGAG
GACCTCATCTCCAGCCAGGTCTACGCCATCCTAGTTAGCCATCCACCTACCCCCAACGAC
CACTTCACTCCCACCCCTGTCTCCTACACAGCCGGCTTCTACCGCATACCCGTGCTGGGG
CTGACCACCCGCATGTCCATCTACTCGGACAAGAGCATCCACCTGAGCTTCCTGCGCACC
GTGCCGCCCTACTCCCACCAGTCCAGCGTGTGGTTTGAGATGATGCGTGTCTACAGCTGG
AACCACATCATCCTGCTGGTCAGCGACGACCACGAGGGCCGGGCGGCTCAGAAACGCCTG
GAGACGCTGCTGGAGGAGCGTGAGTCCAAGGCAGAGAAGGTGCTGCAGTTTGACCCAGGG
ACCAAGAACGTGACGGCCCTGCTGATGGAGGCGAAAGAGCTGGAGGCCCGGGTCATCATC
CTTTCTGCCAGCGAGGACGATGCTGCCACTGTATACCGCGCAGCCGCGATGCTGAACATG
ACGGGCTCCGGGTACGTGTGGCTGGTCGGCGAGCGCGAGATCTCGGGGAACGCCCTGCGC
TACGCCCCAGACGGCATCCTCGGGCTGCAGCTCATCAACGGCAAGAACGAGTCGGCCCAC
ATCAGCGACGCCGTGGGCGTGGTGGCCCAGGCCGTGCACGAGCTCCTCGAGAAGGAGAAC
ATCACCGACCCGCCGCGGGGCTGCGTGGGCAACACCAACATCTGGAAGACCGNNNNNNNN
NNNNAGAGAGTGCTGATGTCTTCCAAGTATGCGGATGGGGTGACTGGTCGCGTGGAGTTC
AATGAGGATGGGGACCGGAAGTTCGCCAACTACAGCATCATGAACCTGCAGAACCGCAAG
CTGGTGCAAGTGGGCATCTACAATGGCACCCACGTCATCCCTAATGACAGGAAGATCATC
TGGCCAGGCGGAGAGACAGAGAAGCCTCGAGGGTACCAGATGTCCACCAGACTGAAGATT
GTGACGATCCACCAGGAGCCCTTCGTGTACGTCAAGCCCACGCTGAGTGATGGGACATGC
AAGGAGGAGTTCACAGTCAACGGCGACCCAGTCAAGAAGGTGATCTGCACCGGGCCCAAC
GACACGTCGCCGGGCAGCCCCCGCCACACGGTGCCTCAGTGTTGCTACGGCTTTTGCATC
GACCTGCTCATCAAGCTGGCACGGACCATGAACTTCACCTACGAGGTGCACCTGGTGGCA
GATGGCAAGTTCGGCACACAGGAGCGGGTGAACAACAGCAACAAGAAGGAGTGGAATGGG
ATGATGGGCGAGCTGCTCAGCGGGCAGGCAGACATGATCGTGGCGCCGCTAACCATAAAC
AACGAGCGCGCGCAGTACATCGAGTTTTCCAAGCCCTTCAAGTACCAGGGCCTGACTATT
CTGGTCAAGAAGGAGATTCCCCGGAGCACGCTGGACTCGTTCATGCAGCCGTTCCAGAGC
ACACTGTGGCTGCTGGTGGGGCTGTCGGTGCACGTGGTGGCCGTGATGCTGTACCTGCTG
GACCGCTTCAGCCCCTTCGGCCGGTTCAAGGTGAACAGCGAGGAGGAGGAGGAGGACGCA
CTGACCCTGTCCTCGGCCATGTGGTTCTCCTGGGGCGTCCTGCTCAACTCCGGCATCGGG
GAAGGCGCCCCCAGAAGCTTCTCAGCGCGCATCCTGGGCATGGTGTGGGCCGGCTTTGCC
ATGATCATCGTGGCCTCCTACACCGCCAACCTGGCGGCCTTCCTGGTGCTGGACCGGCCG
GAGGAGCGCATCACGGGCATCAACGACCCTCGGCTGAGGAACCCCTCGGACAAGTTTATC
TACGCCACGGTGAAGCAGAGCTCCGTGGATATCTACTTCCGGCGCCAGGTGGAGCTGAGC
ACCATGTACCGGCATATGGAGAAGCACAACTACGAGAGTGCGGCGGAGGCCATCCAGGCC
GTGAGAGACAACAAGCTGCATGCCTTCATCTGGGACTCGGCGGTGCTGGAGTTCGAGGCC
TCGCAGAAGTGCGACCTGGTGACGACTGGAGAGCTGTTTTTCCGCTCGGGCTTCGGCATA
GGCATGCGCAAAGACAGCCCCTGGAAGCAGAACGTCTCCCTGTCCATCCTCAAGTCCCAC
GAGAATGGCTTCATGGAAGACCTGGACAAGACGTGGGTTCGGTATCAGGAATGTGACTCG
CGCAGCAACGCCCCTGCGACCCTTACTTTTGAGAACATGGCCGGGGTCTTCATGCTGGTA
GCTGGGGGCATCGTGGCCGGGATCTTCCTGATTTTCATCGAGATTGCCTACAAGCGGCAC
AAGGATGCTCGCCGGAAGCAGATGCAGCTGGCCTTTGCCGCCGTTAACGTGTGGCGGAAG
AACCTGCAGGATAGAAAGAGTGGTAGAGCAGAGCCTGACCCTAAAAAGAAAGCCACATTT
AGGGCTATCACCTCCACCCTGGCTTCCAGCTTCAAGAGGCGTAGGTCCTCCAAAGACACG
AGCACCGGGGGTGGACGCGGCGCTTTGCAAAACCAAAAAGACACAGTGCTGCCGCGACGC
GCTATTGAGAGGGAGGAGGGCCAGCTGCAGCTGTGTTCCCGTCATAGGGAGAGCTGA

Clone variation with respect to NM_007327.3
953 g=>n;954 g=>n;955 c=>n;956 c=>n;957 g=>n;958 c=>n;959 t=>n;960 c=>n;961 t=>n;962 t=>n;963 c=>n;964 a=>n
5' Read Nucleotide Sequence
>OriGene 5' read for NM_007327 unedited
AAAAGGTACCGGCGCCCGTTCCCTTAAAGGGCGGTAGGCGTGCACGGTGGGAGGTCTATA
TAAGCAGAGCTCATTTAGGTGACACTATAGAATACAAGCTACTTGTTCTTTTTGCAGCGG
CCGCGAATTCGGCACGAGGACGGCCCGGAAGCCCCGCGGGGGATGCGCCGAGGGCCCCGC
GTTCGCGCCGCGCAGAGCCAGGCCCGCGGCCTGATCCCATGAGCACCATGCGCCTGCTGA
CGCTCGCCCTGCTGTTCTCCTGCTCCGTCGCCCGTGCCGCGTGCGACCCCAAGATCGTCA
ACATTGGCGCGGTGCTGAGCACGCGGAAGCACGAGCAGATGTTCCGCGAGGCCGTGAACC
AGGCCAACAAGCGGCACGGCTCCTGGAAGATTCAGCTCAATGCCACCTCCGTCACGCACA
AGCCCAACGCCATCCAGATGGCTCTGTCGGTGTGCGAGGACCTCATCTCCAGCCAGGTCT
ACGCCATCCTAGTTAGCCATCCACCTACCCCCAACGACCACTTCACTCCCACCCCTGTCT
CCTACACAGCCGGCTTCTACCGCATACCCGTGCTGGGGCTGACCACCCGCATGTCCATCT
ACTCGGACAAGAGCATCCACCTGAGCTTCCTGCGCACCGTGCCGCCCTACTCCCACCAGT
CCAGCGTGTGGTTTGAGATGATGCGTGTCTACAGCTGGAACCACATCATCCTGCTGGTCA
GCGACGACCACGAGGGCCGGGCGGCTCAGAAACGCCTGGAGACGCTGCTGGAGGAGCGTG
AGTCCCAAGCAGAGAAAGTGCTGCAGTTTGACCCAGGGACCAAAACGTGNACGCCCTGCT
GATGGAGCGAAAGAGCTGGNAGCCGGGTCATCATCCTTTCTGCCAGCGAGGCGATGCTGC
CN
3' Read Nucleotide Sequence
>OriGene 3' read for NM_007327 unedited
NCTACTATGTACCGTGGCCGCGCTCNAAGATCGGTTTTTTTTTTTTTTTTTTGCGTGACA
TTCCTTTAGGCATCACCACTGCATACACCGGGAGGTGGGGGTTGGGCGGTGCGCGCCTGC
ACCCTGGGGACGGAGGGGCAGAGCGCGGCTGCGCACGGGCCGCACGGGGAAGGCACGCGC
TCGGGCCCTGGGAGTGCTGGTTCTGTACAAGGTGGCGGGCCGGTCACGCACCCGGATCGA
GGGCGGGGGCGGGCGGGTGGCGCTCTCCCGTGCCCAAGGTGCAGGGCAGGGTTGAAGACA
GTCCCGAGCCAGCGTCCGGGGACCCCCGGGGAGGCCCGTTCTGGGCTGCAGGCCGGACGA
GGAGAGGAGGGGCTCAGCCCTCTCGAGTCTGGAGGATGCGGCCCGAGGCGGCGGGAGGCG
CTGCCAGCTGGGAAGTCAGGGACGGCCGTGGGGGATGGCAGGGCCAGCCCCGGCGTGTGG
GGTCAAGGGGCATACGGGGTGTGGGTGGGCGGTGCCGCAAGAAGAGGGGAGGGTGGAGCT
CAAGCTGCAGAGGAGCGCATGCGCCCGATGAGGGGCGACCCAGCCAGCTGGTGCCATGGG
CCCCCACTGTGGCTCATGCTGGTGCTGCGGGAATGATGGGGGCTGCCGTCTCTGCTTCCA
GCCCCTTCGGCTGGGGCCAGTTAGCCCCCGCTCCCCACTGCTTATAGACCATAAGGCCCT
GCCTCTGGCGGGAGCGCCCTGGGGCCTTGGCCCAGCCGACTCAACTTTGGCCCGTTCTTA
ACCGTTTCGGGTCGGACCTTGGTTCCACAAGGGCTGCCCGCCCGGCATCGGGTGGGCCGG
GCCGGCGGACGGGAGGCCCAGGTGGGCAGTCTTCTGGGGCGGTGGGGCTTCCCCAGGCCT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_007327
ORF Size 2817 bp
Insert Size 4700
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_007327.1, NP_015566
RefSeq Size 5137
Locus ID 2902
Cytogenetics 9q34.3
Protein Families Transmembrane, Ion Channels: Glutamate Receptors, Druggable Genome
Protein Pathways Calcium signaling pathway, Neuroactive ligand-receptor interaction, Long-term potentiation, Alzheimer's disease, Amyotrophic lateral sclerosis (ALS), Huntington's disease
Gene Summary The protein encoded by this gene is a critical subunit of N-methyl-D-aspartate receptors, members of the glutamate receptor channel superfamily which are heteromeric protein complexes with multiple subunits arranged to form a ligand-gated ion channel. These subunits play a key role in the plasticity of synapses, which is believed to underlie memory and learning. Cell-specific factors are thought to control expression of different isoforms, possibly contributing to the functional diversity of the subunits. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (GluN1-1a, also known as NR1-3) represents the longest transcript and encodes protein isoform GluN1-1a (also known as isoform NR1-3).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.