AVPR V2(AVPR2) (NM_000054) Human Untagged Clone

CAT#: SC115220

AVPR2 (untagged)-Human arginine vasopressin receptor 2 (AVPR2), transcript variant 1

USD 721.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name AVPR V2(AVPR2) (NM_000054) Human Untagged Clone
Symbol AVPR2
Synonyms ADHR; DI1; DIR; DIR3; NDI; V2R
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000054, RT-PCR generated
ATGCTCATGGCGTCCACCACTTCCGCTGTGCCTGGGCATCCCTCTCTGCCCAGCCTGCCC
AGCAACAGCAGCCAGGAGAGGCCACTGGACACCCGGGACCCGCTGCTAGCCCGGGCGGAG
CTGGCGCTGCTCTCCATAGTCTTTGTGGCTGTGGCCCTGAGCAATGGCCTGGTGCTGGCG
GCCCTAGCTCGGCGGGGCCGGCGGGGCCACTGGGCACCCATACACGTCTTCATTGGCCAC
TTGTGCCTGGCCGACCTGGCCGTGGCTCTGTTCCAAGTGCTGCCCCAGCTGGCCTGGAAG
GCCACCGACCGCTTCCGTGGGCCAGATGCCCTGTGTCGGGCCGTGAAGTATCTGCAGATG
GTGGGCATGTATGCCTCCTCCTACATGATCCTGGCCATGACGCTGGACCGCCACCGTGCC
ATCTGCCGTCCCATGCTGGCGTACCGCCATGGAAGTGGGGCTCACTGGAACCGGCCGGTG
CTAGTGGCTTGGGCCTTCTCGCTCCTTCTCAGCCTGCCCCAGCTCTTCATCTTCGCCCAG
CGCAACGTGGAAGGTGGCAGCGGGGTCACTGACTGCTGGGCCTGCTTTGCGGAGCCCTGG
GGCCGTCGCACCTATGTCACCTGGATTGCCCTGATGGTGTTCGTGGCACCTACCCTGGGT
ATCGCCGCCTGCCAGGTGCTCATCTTCCGGGAGATTCATGCCAGTCTGGTGCCAGGGCCA
TCAGAGAGGCCTGGGGGGCGCCGCAGGGGACGCCGGACAGGCAGCCCCGGTGAGGGAGCC
CACGTGTCAGCAGCTGTGGCCAAGACTGTGAGGATGACGCTAGTGATTGTGGTCGTCTAT
GTGCTGTGCTGGGCACCCTTCTTCCTGGTGCAGCTGTGGGCCGCGTGGGACCCGGAGGCA
CCTCTGGAAGGGGCGCCCTTTGTGCTACTCATGTTGCTGGCCAGCCTCAACAGCTGCACC
AACCCCTGGATCTATGCATCTTTCAGCAGCAGCGTGTCCTCAGAGCTGCGAAGCTTGCTC
TGCTGTGCCCGGGGACGCACCCCACCCAGCCTGGGTCCCCAAGATGAGTCCTGCACCACC
GCCAGCTCCTCCCTGGCCAAGGACACTTCATCGTGA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000054 unedited
GGGGAACTTGGATTTGTAAACGACTTATATAGGCGGCCGCGNAATCAGATCTGGTACCGA
GCTCGGATCCACTAGTAACGGCCGCCAGTGTGCTGGAATTCGGCTTATGCTCATGGCGTC
CACCACTTCCGCTGTGCCTGGGCATCCCTCTCTGCCCAGCCTGCCCAGCAACAGCAGCCA
GGAGAGGCCACTGGACACCCGGGACCCGCTGCTAGCCCGGGCGGAGCTGGCGCTGCTCTC
CATAGTCTTTGTGGCTGTGGCCCTGAGCAATGGCCTGGTGCTGGCGGCCCTAGCTCGGCG
GGGCCGGCGGGGCCACTGGGCACCCATACACGTCTTCATTGGCCACTTGTGCCTGGCCGA
CCTGGCCGTGGCTCTGTTCCAAGTGCTGCCCCAGCTGGCCTGGAAGGCCACCGACCGCTT
CCGTGGGCCAGATGCCCTGTGTCGGGCCGTGAAGTATCTGCAGATGGTGGGCATGTATGC
CTCCTCCTACATGATCCTGGCCATGACGCTGGACCGCCACCGTGCCATCTGCCGTCCCAT
GCTGGCGTACCGCCATGGAAGTGGGGCTCACTGGAACCGGCCGGTGCTAGTGGCTTGGGC
CTTCTCGCTCCTTCTCAGCCTGCCCCAGCTCTTCATCTTCGCCCAGCGCAACGTGGAAGG
TGGCAGCGGGGTCACTGACTGCTGGGCCTGCTTTGCGGAGCCCTGGGGCCGTCGCACCTA
TGTCACCTGGATTGCCCTGATGGTGTTCGTGGCACCTACCCTGNGTATCGCCGCCTGCCA
GGTGCTCATCTTCCGGGAGATTCATGCCAGTCTGGTGCCAGGGCCATCAGAGAGGCCCTG
GGGGGCCGCCGCAGGGGACGCCGGACAGGCAGCCCCGGTGAGGGAGCCCACGTGTCAGCA
GCTA
Tag Tag Free
ACCN NM_000054
ORF Size 1116 bp
Insert Size 1500
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000054.2, NP_000045
RefSeq Size 1809
Locus ID 554
Cytogenetics Xq28
Protein Families GPCR, Transmembrane, Druggable Genome
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary This gene encodes the vasopressin receptor, type 2, also known as the V2 receptor, which belongs to the seven-transmembrane-domain G protein-coupled receptor (GPCR) superfamily, and couples to Gs thus stimulating adenylate cyclase. The subfamily that includes the V2 receptor, the V1a and V1b vasopressin receptors, the oxytocin receptor, and isotocin and mesotocin receptors in non-mammals, is well conserved, though several members signal via other G proteins. All bind similar cyclic nonapeptide hormones. The V2 receptor is expressed in the kidney tubule, predominantly in the distal convoluted tubule and collecting ducts, where its primary property is to respond to the pituitary hormone arginine vasopressin (AVP) by stimulating mechanisms that concentrate the urine and maintain water homeostasis in the organism. When the function of this gene is lost, the disease Nephrogenic Diabetes Insipidus (NDI) results. The V2 receptor is also expressed outside the kidney although its tissue localization is uncertain. When these 'extrarenal receptors' are stimulated by infusion of a V2 selective agonist (dDAVP), a variety of clotting factors are released into the bloodstream. The physiologic importance of this property is not known - its absence does not appear to be detrimental in NDI patients. The gene expression has also been described in fetal lung tissue and lung cancer associated with alternative splicing. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (1) encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.