Apolipoprotein CIII (APOC3) (NM_000040) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | Apolipoprotein CIII |
Synonyms | APOCIII |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene ORF within SC113775 sequence for NM_000040 edited (data generated by NextGen Sequencing)
ATGCAGCCCCGGGTACTCCTTGTTGTTGCCCTCCTGGCGCTCCTGGCCTCTGCCCGAGCT TCAGAGGCCGAGGATGCCTCCCTTCTCAGCTTCATGCAGGGCTACATGAAGCACGCCACC AAGACCGCCAAGGATGCACTGAGCAGCGTGCAGGAGTCCCAGGTGGCCCAGCAGGCCAGG GGCTGGGTGACCGATGGCTTCAGTTCCCTGAAAGACTACTGGAGCACCGTTAAGGACAAG TTCTCTGAGTTCTGGGATTTGGACCCTGAGGTCAGACCAACTTCAGCCGTGGCTGCCTGA Clone variation with respect to NM_000040.1 102 t=>c
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000040 unedited
GCACGAGGTTCATCCCTAGAGGCAGCTGCTCCAGGAACAGAGGTGCCATGCAGCCCCGGG TACTCCTTGTTGTTGCCCTCCTGGCGCTCCTGGCCTCTGCCCGAGCTTCAGAGGCCGAGG ATGCCTCCCTTCTCAGCTTCATGCAGGGCTACATGAAGCACGCCACCAAGACCGCCAAGG ATGCACTGAGCAGCGTGCAGGAGTCCCAGGTGGCCCAGCAGGCCAGGGGCTGGGTGACCG ATGGCTTCAGTTCCCTGAAAGACTACTGGAGCACCGTTAAGGACAAGTTCTCTGAGTTCT GGGATTTGGACCCTGAGGTCAGACCAACTTCAGCCGTGGCTGCCTGAGACCTCAATACCC CAAGTCCACCTGCCTATCCATCCTGCCAGCTCCTTGGGTCCTGCAATCTCCAGGGCTTCC CCTGTAGGTTGCTTAAAAGGGACAGTATTCTCAGTGCTCTCCTACCCCACCTCATGCCTG GCCCCCCTCCAGGCATGCTGGCCTCCCAATAAAGCTGGACAAGAAGCTGCTAN |
Restriction Sites | NotI-NotI |
ACCN | NM_000040 |
Insert Size | 660 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_000040.1, NP_000031.1 |
RefSeq Size | 533 bp |
RefSeq ORF | 300 bp |
Locus ID | 345 |
UniProt ID | P02656 |
Cytogenetics | 11q23.3 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | PPAR signaling pathway |
Summary | This gene encodes a protein component of triglyceride (TG)-rich lipoproteins (TRLs) including very low density lipoproteins (VLDL), high density lipoproteins (HDL) and chylomicrons. The encoded protein plays a role in role in the metabolism of these TRLs through multiple modes. This protein has been shown to promote the secretion of VLDL1, inhibit lipoprotein lipase enzyme activity, and delay catabolism of TRL remnants. Mutations in this gene are associated with low plasma triglyceride levels and reduced risk of ischemic cardiovascular disease, and hyperalphalipoproteinemia, which is characterized by elevated levels of high density lipoprotein (HDL) and HDL cholesterol in human patients. This gene and other related genes comprise an apolipoprotein gene cluster on chromosome 11. [provided by RefSeq, Sep 2017] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC206566 | APOC3 (Myc-DDK-tagged)-Human apolipoprotein C-III (APOC3) | 10 ug |
$150.00
|
|
RC206566L1 | Lenti ORF clone of Human apolipoprotein C-III (APOC3), Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC206566L2 | Lenti ORF clone of Human apolipoprotein C-III (APOC3), mGFP tagged | 10 ug |
$450.00
|
|
RC206566L3 | Lenti ORF clone of Human apolipoprotein C-III (APOC3), Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC206566L4 | Lenti ORF clone of Human apolipoprotein C-III (APOC3), mGFP tagged | 10 ug |
$450.00
|
|
RG206566 | APOC3 (tGFP-tagged) - Human apolipoprotein C-III (APOC3) | 10 ug |
$489.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.