DLL4 (NM_019074) Human Untagged Clone

CAT#: SC113239

DLL4 (untagged)-Human delta-like 4 (Drosophila) (DLL4)

USD 721


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name DLL4 (NM_019074) Human Untagged Clone
Symbol DLL4
Synonyms hdelta2
Vector pCMV6-XL6
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC113239 sequence for NM_019074 edited (data generated by NextGen Sequencing)
ATGGCGGCAGCGTCCCGGAGCGCCTCTGGCTGGGCGCTACTGCTGCTGGTGGCACTTTGG
CAGCAGCGCGCGGCCGGCTCCGGCGTCTTCCAGCTGCAGCTGCAGGAGTTCATCAACGAG
CGCGGCGTACTGGCCAGTGGGCGGCCTTGCGAGCCCGGCTGCCGGACTTTCTTCCGCGTC
TGCCTTNAGCACTTCCAGGCGGTCGTCTCGCCCGGACCCTGCACCTTCGGGACCGTCTCC
ACGCCGGTATTGGGCACCAACTCCTTCGCTGTCCGGGACGACAGTAGCGGCGGGGGGCGC
AACCCTCTCCAACTGCCCTTCAATTTCACCTGGCCGGGTACCTTCTCGCTCATCATCGAA
GCTTGGCACGCGCCAGGAGACGACCTGCGGCCAGAGGCCTTGCCACCAGATGCACTCATC
AGCAAGATCGCCATCCAGGGCTCCCTAGCTGTGGGTCAGAACTGGTTATTGGATGAGCAA
ACCAGCACCCTCACAAGGCTGCGCTACTCTTACCGGGTCATCTGCAGTGACAACTACTAT
GGAGACAACTGCTCCCGCCTGTGCAAGAAGCGCAATGACCACTTCGGCCACTATGTGTGC
CAGCCAGATGGCAACTTGTCCTGCCTGCCCGGTTGGACTGGGGAATATTGCCAACAGCCT
ATCTGTCTTTCGGGCTGTCATGAACAGAATGGCTACTGCAGCAAGCCAGCAGAGTGCCTC
TGCCGCCCAGGCTGGCAGGGCCGGCTGTGTAACGAATGCATCCCCCACAATGGCTGTCGC
CACGGCACCTGCAGCACTCCCTGGCAATGTACTTGTGATGAGGGCTGGGGAGGCCTGTTT
TGTGACCAAGATCTCAACTACTGCACCCACCACTCCCCATGCAAGAATGGGGCAACGTGC
TCCAACAGTGGGCAGCGAAGCTACACCTGCACCTGTCGCCCAGGCTACACTGGTGTGGAC
TGTGAGCTGGAGCTCAGCGAGTGTGACAGCAACCCCTGTCGCAATGGAGGCAGCTGTAAG
GACCAGGAGGATGGCTACCACTGCCTGTGTCCTCCGGGCTACTATGGCCTGCATTGTGAA
CACAGCACCTTGAGCTGCGCCGACTCCCCCTGCTTCAATGGGGGCTCCTGCCGGGAGCGC
AACCAGGGGGCCAACTATGCTTGTGAATGTCCCCCCAACTTCACCGGCTCCAACTGCGAG
AAGAAAGTGGACAGGTGCACCAGCAACCCCTGTGCCAACGGGGGACAGTGCCTGAACCGA
GGTCCAAGCCGCATGTGCCGCTGCCGTCCTGGATTCACGGGCACCTACTGTGAACTCCAC
GTCAGCGACTGTGCCCGTAACCCTTGCGCCCACGGTGGCACTTGCCATGACCTGGAGAAT
GGGCTCATGTGCACCTGCCCTGCCGGCTTCTCTGGCCGACGCTGTGAGGTGCGGACATCC
ATCGATGCCTGTGCCTCGAGTCCCTGCTTCAACAGGGCCACCTGCTACACCGACCTCTCC
ACAGACACCTTTGTGTGCAACTGCCCTTATGGCTTTGTGGGCAGCCGCTGCGAGTTCCCC
GTGGGCTTGCCGCCCAGCTTCCCCTGGGTGGCCGTCTCGCTGGGTGTGGGGCTGGCAGTG
CTGCTGGTACTGCTGGGCATGGTGGCAGTGGCTGTGCGGCAGCTGCGGCTTCGACGGCCG
GACGACGGCAGCAGGGAAGCCATGAACAACTTGTCGGACTTCCAGAAGGACAACCTGATT
CCTGCCGCCCAGCTTAAAAACACAAACCAGAAGAAGGAGCTGGAAGTGGACTGTGGCCTG
GACAAGTCCAACTGTGGCAAACAGCAAAACCACACATTGGACTATAATCTGGCCCCAGGG
CCCCTGGGGCGGGGGACCATGCCAGGAAAGTTTCCCCACAGTGACAAGAGCTTAGGAGAG
AAGGCGCCACTGCGGTTACACAGTGAAAAGCCAGAGTGTCGGATATCAGCGATATGCTCC
CCCAGGGACTCCATGTACCAGTCTGTGTGTTTGATATCAGAGGAGAGGAATGAATGTGTC
ATTGCCACGGAGGTATAA

Clone variation with respect to NM_019074.3
187 a=>n
5' Read Nucleotide Sequence
>OriGene 5' read for NM_019074 unedited
CCCCCGCCCTGTTGCCGCAAAGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAG
AGCTCATTTAGGTGACACTATAGAATACAAGCTACTTGTTCTTTTTGCAGCGGCCGCGAA
TTCGGCACGAGGCTGCGCGCAGGCCGGGAACACGAGGCCAAGAGCCGCAGCCCCAGCCGC
CTTGGTGCAGCGTACACCGGCACTAGCCCGCTTGCAGCCCCAGGATTAGACAGAAGACGC
GTCCTCGGCGCGGTCGCCGCCCAGCCGTAGTCACCTGGATTACCTACAGCGGCAGCTGCA
GCGGAGCCAGCGAGAAGGCCAAAGGGGAGCAGCGTCCCGAGAGGAGCGCCTCTTTTCAGG
GACCCCGCCGGCTGGCGGACGCGCGGGAAAGCGGCGTCGCGAACAGAGCCAGATTGAGGG
CCCGCGGGTGGAGAGAGCGACGCCCGAGGGGATGGCGGCAGCGTCCCGGAGCGCCTCTGG
CTGGGCGCTACTGCTGCTGGTGGCACTTTGGCAGCAGCGCGCGGCCGGCTCCGGCGTCTT
CCAGCTGCAGCTGCAGGAGTTCATCAACGAGCGCGGCGTACTGGCCAGTGGGCGGCCTTG
CGAGCCCGGCTGCCGGACTTTCTTCCGCGTCTGCCTTAAGCACTTCCAGGCGGTCGTCTC
GCCCGGACCCTGCACCTTCGGGACCGTCTCCACGCCGGTATTGGGCACCAACTCCTTCGC
TGTCCGGGACGACAGTAGCGGCGGGGGGCGNCACCCTCTNCACTGCCCTTCATNTCACCT
GGCCGGGTACCTTCTCGCTCATCATCGAAGCTGGCCACGCGCCAGGAGACGACCTGGCGG
CAGAGGCCTTGNCACCAGATGCACTCATCAGCAAGATCGCCATCCAGGGCTCCCTAGCTG
TGGGTCAGAACTGGGTATGGGNATGAGCAACAGCACCTNACAGGCTGCGCTACTCTTACC
GGTCATCTGCATGC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_019074 unedited
GTTTATCTATGNNACCGCGGCCGCAATCTAGGATCGAGTTTTTTTTTTTTTTTTTTCCTG
TACACATCTGTTTCATATTATAAATACACATTATATACAAAATAATGTTATAAAATGTAG
AAAGGTCAGTGCTTCTGATTCTTAAATTATTGAAATACTAGACTCCAAAATAAACTACAA
AAAAAAAAAAAAAAACAAAATAAAAACTCATATTATTGATTTCTGAAAACCAGCTTTGAG
GGTGGTCTGGGGCAGTAGTGGACCAAAGCCCAGGCTCGAGGTTGTGGAAATGGGCTTGAG
GGAGGAAAGGGCCCAGGCGGCCGCAGCACCTGATTTCCCCCTCAGTGGAATTTCCAACAC
ACTGCCCTGAGTGCCCCAGTTAGGCCTGGCACCCTTGGCTGGTGGGAGGGGCAGGCCCTC
TGCCTGTCTGCTTACAGAAGCCCAGGGCCAAAGGGTGGTGGAAGCCGGGTAAACGGACAT
TCTTGCCCAAAGGGCCTAGACCAAAGAGCCAGGCCTGCATACAGTAATTGGAGGCATGGG
GCANAAAGCACTCCCCTCCCTNGAGCACTCACCTCACCTCCAGGGGAAACCCCAGCAAGA
GACCCACCCCAGTGGTTTTTCAACCCACAAGAGGCCCCTGCCCTCATTGGCCCCCCTCTC
TCCTTTCTGATTTGGGCCCCAACTGTCGCCGTGGAGACCCGGGCCAAAGCACCTTTTGGA
ACACCGAAGCCCATTGGAGGCCACAAAAACTTCCGGGCCCCATGGGGCTACTGGCACCTC
TCTTCGGGAAAAAGGGCCGGAACCCCGGAAGGAGCCCCCTGGAGGCCCCTTATGGGAGGG
GAAGGGCCCAATGGCTTCCTCTCTCCCTTTTGGTCCCCCGGGGGGGGGGCACTTGCCATT
TTGATGCCCAAAGAACCCCAAA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_019074
ORF Size 2058 bp
Insert Size 4000
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_019074.2, NP_061947
RefSeq Size 3383
RefSeq ORF 2058
Locus ID 54567
Cytogenetics 15q15.1
Domains DSL, EGF
Protein Families Stem cell relevant signaling - DSL/Notch pathway, ES Cell Differentiation/IPS, Transmembrane, Cancer stem cells, Druggable Genome
Protein Pathways Notch signaling pathway
Gene Summary This gene is a homolog of the Drosophila delta gene. The delta gene family encodes Notch ligands that are characterized by a DSL domain, EGF repeats, and a transmembrane domain. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations