CDK4 (NM_000075) Human Untagged Clone

CAT#: SC112998

CDK4 (untagged)-Human cyclin-dependent kinase 4 (CDK4)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name CDK4 (NM_000075) Human Untagged Clone
Symbol CDK4
Synonyms CMM3; PSK-J3
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC112998 sequence for NM_000075 edited (data generated by NextGen Sequencing)
ATGGCTACCTCTCGATATGAGCCAGTGGCTGAAATTGGTGTCGGTGCCTATGGGACAGTG
TACAAGGCCCGTGATCCCCACAGTGGCCACTTTGTGGCCCTCAAGAGTGTGAGAGTCCCC
AATGGAGGAGGAGGTGGAGGAGGCCTTCCCATCAGCACAGTTCGTGAGGTGGCTTTACTG
AGGCGACTGGAGGCTTTTGAGCATCCCAATGTTGTCCGGCTGATGGACGTCTGTGCCACA
TCCCGAACTGACCGGGAGATCAAGGTAACCCTGGTGTTTGAGCATGTAGACCAGGACCTA
AGGACATATCTGGACAAGGCACCCCCACCAGGCTTGCCAGCCGAAACGATCAAGGATCTG
ATGCGCCAGTTTCTAAGAGGCCTAGATTTCCTTCATGCCAATTGCATCGTTCACCGAGAT
CTGAAGCCAGAGAACATTCTGGTGACAAGTGGTGGAACAGTCAAGCTGGCTGACTTTGGC
CTGGCCAGAATCTACAGCTACCAGATGGCACTTACACCCGTGGTTGTTACACTCTGGTAC
CGAGCTCCCGAAGTTCTTCTGCAGTCCACATATGCAACACCTGTGGACATGTGGAGTGTT
GGCTGTATCTTTGCAGAGATGTTTCGTCGAAAGCCTCTCTTCTGTGGAAACTCTGAAGCC
GACCAGTTGGGCAAAATCTTTGACCTGATTGGGCTGCCTCCAGAGGATGACTGGCCTCGA
GATGTATCCCTGCCCCGTGGAGCCTTTCCCCCCAGAGGGCCCCGCCCAGTGCAGTCGGTG
GTACCTGAGATGGAGGAGTCGGGAGCACAGCTGCTGCTGGAAATGCTGACTTTTAACCCA
CACAAGCGAATCTCTGCCTTTCGAGCTCTGCAGCACTCTTATCTACATAAGGATGAAGGT
AATCCGGAGTGA

Clone variation with respect to NM_000075.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000075 unedited
ACCATTAGTATACGACTCACTATAGGGCGGCCGCGAAATTCGCACGAGGGTCTATGGTCG
GGCCCTCTGCGTCCAGCTGCTCCGGACCGAGCTCGGGTGTATGGGGCCGTAGGAACCGGC
TCCGGGGCCCCGATAACGGGCCGCCCCCACAGCACCCCGGGCTGGCGTGAGGGTCTCCCT
TGATCTGAGAATGGCTACCTCTCGATATGAGCCAGTGGCTGAAATTGGTGTCGGTGCCTA
TGGGACAGTGTACAAGGCCCGTGATCCCCACAGTGGCCACTTTGTGGCCCTCAAGAGTGT
GAGAGTCCCCAATGGAGGAGGAGGTGGAGGAGGCCTTCCCATCAGCACAGTTCGTGAGGT
GGCTTTACTGAGGCGACTGGAGGCTTTTGAGCATCCCAATGTTGTCCGGCTGATGGACGT
CTGTGCCACATCCCGAACTGACCGGGAGATCAAGGTAACCCTGGTGTTTGAGCATGTAGA
CCAGGACCTAAGGACATATCTGGACAAGGCACCCCCACCAGGCTTGCCAGCCGAAACGAT
CAAGGATCTGATGCGCCAGTTTCTAAGAGGCCTAGATTTCCTTCATGCCAATTGCATCGT
TCACCGAGATCTGAAGCCAGAGAACATTCTGGTGACAAGTGGTGGAACAGTCAAGCTGGC
TGACTTTGGCCTGGCCAGAATCTACAGCTACCAGATGGCACTCACACCCGTGGTTGTTAC
ACTCTGGTACCGAGCTCCCGAAGTTCTTCTGCAGTCCACATATGCCACACCTGTGGACAT
GTGTAGTGTTGGCTGTATCTTTGCAGAGATGTTCCGTCGGAAGCCTCTCTCCTGTGGAAA
CTCTGAAACCGACCAGGTGGGGCAAAACTTTGCCCTGANTGGCTGCCTCCACAGTAGACT
GTCCTCGAGAGTATCCCTGCCCCGTGAAGCCCTTTCCCCCAAAGG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000075 unedited
ACCGCGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTAAAAATCTATATTCTTT
TTTTTTTTTTTGACACAGAGTCTTGCTCTGTTGCCCAAGCTGGAGTGCAATGGCATGATC
TCGGCTCACCGCAACCTCTGCCTCCCGGGTTCAAGCGATCCTCCTGCCTCAGTCTCCCAA
GTAGCTGGGATTACAGGTGTGCACCACCACGCCTGACTAATTTTGTATTTTTAGTAAAGA
CAGGGTTTCACCATGTTAGTCAGGCTGGTCTCGAACTCCTGACCTCAGGTGATCCACCCG
CGTTGGCCTCCCAACGTGCTGGGATTATAGGCGTGAGCCACCACGCCCCGCCTAAAATCC
ATATTCAAAGAAGCAATTTCAGTTCCTTTCTAAGCTTTGTCAGTCAAGGGGCTCCACTGA
CTTCCTAGGCCCTGTAATTTAACCAGTCTTTAAGGTTTTGCAGGAAAGTCCCTTCTTCCA
AGTGGTTTTTCCAAATCGCACAATGGCAAAGCCAAACCGAGGAAGAAACATTAAAAAAAA
AAAAAAGACCATTATTTCTTTGTTTCGCTTTTCCTGTATAAAAAAGGACCCCCAATATAA
AGGTAGGGAAAGGGACAAGAGGGAACATACCCCTTACTGTATAGAAATGGGAAGGAGAAG
GAAAACCCTCCAAAGGAGAGGTGGGAGGGGACTGTCATTTAAGGCGCAAAAGTATTCTCT
GTACACAGATGGAGGAAGACCTTCCATATCCTCAGAGATAAAGGCCAAAATTGCCCTTTC
ACTCGTCACAAGGAAAAGGGAGCTTTTCTTCTTTCCTGGCAGCCACTCCTTTGCTCCTTC
CGGATACCTTCTCCTTATGTAAATAAGAGGCTGCAAACCCTGAAAAGCATATATTGCTTG
TGGGGCTTAAAGTCAAAATTTCCCCACAGCTGGGCTC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000075
ORF Size 912 bp
Insert Size 1960
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000075.2, NP_000066
RefSeq Size 1474
Locus ID 1019
Cytogenetics 12q14.1
Domains pkinase, TyrKc, S_TKc
Protein Families Protein Kinase, Druggable Genome
Protein Pathways Cell cycle, p53 signaling pathway, Tight junction, T cell receptor signaling pathway, Pathways in cancer, Pancreatic cancer, Glioma, Melanoma, Bladder cancer, Chronic myeloid leukemia, Small cell lung cancer, Non-small cell lung cancer
Gene Summary The protein encoded by this gene is a member of the Ser/Thr protein kinase family. This protein is highly similar to the gene products of S. cerevisiae cdc28 and S. pombe cdc2. It is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 phase progression. The activity of this kinase is restricted to the G1-S phase, which is controlled by the regulatory subunits D-type cyclins and CDK inhibitor p16(INK4a). This kinase was shown to be responsible for the phosphorylation of retinoblastoma gene product (Rb). Mutations in this gene as well as in its related proteins including D-type cyclins, p16(INK4a) and Rb were all found to be associated with tumorigenesis of a variety of cancers. Multiple polyadenylation sites of this gene have been reported. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) encodes the full length protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations