CD32A(FCGR2A) (NM_021642) Human Untagged Clone

CAT#: SC112914

FCGR2A (untagged)-Human Fc fragment of IgG, low affinity IIa, receptor (CD32) (FCGR2A), transcript variant 2

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name CD32A(FCGR2A) (NM_021642) Human Untagged Clone
Symbol FCGR2A
Synonyms CD32; CD32A; CDw32; FCG2; FcGR; FCGR2; FCGR2A1; IGFR2
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_021642, the custom clone sequence may differ by one or more nucleotides


ATGACTATGGAGACCCAAATGTCTCAGAATGTATGTCCCAGAAACCTGTGGCTGCTTCAACCATTGACAG
TTTTGCTGCTGCTGGCTTCTGCAGACAGTCAAGCTGCTCCCCCAAAGGCTGTGCTGAAACTTGAGCCCCC
GTGGATCAACGTGCTCCAGGAGGACTCTGTGACTCTGACATGCCAGGGGGCTCGCAGCCCTGAGAGCGAC
TCCATTCAGTGGTTCCACAATGGGAATCTCATTCCCACCCACACGCAGCCCAGCTACAGGTTCAAGGCCA
ACAACAATGACAGCGGGGAGTACACGTGCCAGACTGGCCAGACCAGCCTCAGCGACCCTGTGCATCTGAC
TGTGCTTTCCGAATGGCTGGTGCTCCAGACCCCTCACCTGGAGTTCCAGGAGGGAGAAACCATCATGCTG
AGGTGCCACAGCTGGAAGGACAAGCCTCTGGTCAAGGTCACATTCTTCCAGAATGGAAAATCCCAGAAAT
TCTCCCATTTGGATCCCACCTTCTCCATCCCACAAGCAAACCACAGTCACAGTGGTGATTACCACTGCAC
AGGAAACATAGGCTACACGCTGTTCTCATCCAAGCCTGTGACCATCACTGTCCAAGTGCCCAGCATGGGC
AGCTCTTCACCAATGGGGATCATTGTGGCTGTGGTCATTGCGACTGCTGTAGCAGCCATTGTTGCTGCTG
TAGTGGCCTTGATCTACTGCAGGAAAAAGCGGATTTCAGCCAATTCCACTGATCCTGTGAAGGCTGCCCA
ATTTGAGCCACCTGGACGTCAAATGATTGCCATCAGAAAGAGACAACTTGAAGAAACCAACAATGACTAT
GAAACAGCTGACGGCGGCTACATGACTCTGAACCCCAGGGCACCTACTGACGATGATAAAAACATCTACC
TGACTCTTCCTCCCAACGACCATGTCAACAGTAATAACTAA


Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_021642
ORF Size 951 bp
Insert Size 2250
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_021642.3, NP_067674
RefSeq Size 2426
RefSeq ORF 951
Locus ID 2212
Cytogenetics 1q23.3
Domains ig, IGc2, IG
Protein Families ES Cell Differentiation/IPS, Transmembrane
Protein Pathways Fc gamma R-mediated phagocytosis, Systemic lupus erythematosus
Gene Summary This gene encodes one member of a family of immunoglobulin Fc receptor genes found on the surface of many immune response cells. The protein encoded by this gene is a cell surface receptor found on phagocytic cells such as macrophages and neutrophils, and is involved in the process of phagocytosis and clearing of immune complexes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2008]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1, resulting in a shorter protein (isoform 2), compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.