TMEM35 (TMEM35A) (NM_021637) Human Untagged Clone

CAT#: SC112910

Reviews ()
Write a review

TMEM35 (untagged)-Human transmembrane protein 35 (TMEM35)



  "NM_021637" in other vectors (4)

Reconstitution Protocol

USD 300.00


Availability*
In Stock

Size
    • 10 ug


Product images

Other products for "TMEM35A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TMEM35A
Synonyms NACHO; TMEM35; TUF-1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC112910 sequence for NM_021637 edited (data generated by NextGen Sequencing)
ATGGCATCCCCCAGAACCGTAACTATTGTGGCCCTCTCAGTGGCCCTGGGACTCTTCTTT
GTTTTCATGGGGACTATCAAGCTGACCCCCAGGCTCAGCAAGGATGCCTACAGTGAGATG
AAACGTGCTTACAAGAGCTATGTTCGAGCCCTCCCTCTGCTGAAGAAAATGGGGATCAAT
TCCATTCTCCTCCGAAAAAGCATTGGTGCCCTTGAAGTGGCCTGTGGCATCGTCATGACC
CTTGTGCCTGGGCGTCCCAAAGATGTGGCCAACTTCTTCCTACTGTTGCTGGTGTTGGCT
GTGCTCTTCTTCCACCAGCTGGTCGGTGATCCTCTCAAACGCTACGCCCATGCTCTGGTG
TTTGGAATCCTGCTCACTTGCCGCCTGCTGATTGCTCGCAAGCCCGAAGACCGGTCTTCT
GAGAAGAAGCCTTTGCCAGGGAATGCTGAGGAGCAACCCTCCTTATATGAGAAGGCCCCT
CAGGGCAAAGTGAAGGTGTCATAG

Clone variation with respect to NM_021637.2
>OriGene 5' read for NM_021637 unedited
GTAAAGGACGTACCGTTGTATAACGCCTCCTAATAGGGCGGCCCGCGACTCTTCGGCAAC
GAGTCCTCGTGCCGAATTCGGCACGAGGCCTTTGTCATTCTAGCTGCCTGCTGCCTCCGC
AGCGTCCCCCCAGCTCTCCCTGTGCTAACTGCCTGCACCTTGGACAGAGCGGGTGCGCAA
ATCAGAAGGATTAGTTGGGACCTGCCTTGGCGACCCCATGGCATCCCCCAGAACCGTAAC
TATTGTGGCCCTCTCAGTGGCCCTGGGACTCTTCTTTGTTTTCATGGGGACTATCAAGCT
GACCCCCAGGCTCAGCAAGGATGCCTACAGTGAGATGAAACGTGCTTACAAGAGCTATGT
TCGAGCCCTCCCTCTGCTGAAGAAAATGGGGATCAATTCCATTCTCCTCCGAAAAAGCAT
TGGTGCCCTTGAAGTGGCCTGTGGCATCGTCATGACCCTTGTGCCTGGGCGTCCCAAAGA
TGTGGCCAACTTCTTCCTACTGTTGCTGGTGTTGGCTGTGCTCTTCTTCCACCAGCTGGT
CGGTGATCCTCTCAAACGCTACGCCCATGCTCTGGTGTTTGGAATCCTGCTCACTTGCCG
CCTGCTGATTGCTCGCAAGCCCGAAGACCGGTCTTCTGAGAAGAAGCCTTTGCCAGGGAA
TGCTGAGGAGCAACCCTCCTTATATGAGAAGGCCCCTCAGGGCAAAGTGAAGGTGTCATA
GAAAAGTGGAAGTGCAAAGAGTGGACCTTCCAGGCAGTTGCGTCCATGACACCAGGAAGA
TGTCAGTGTGTGTTTTTCATTTGATTTATTTATCTTGGGGAAAGTGAAAAATGTAATCTG
CAAGTTAATGACCCTATTGGCTTGTGTACATCTATATGCTAAAATGACTTCCCCACATTG
ACATTTGTGCGCCACCTTTTATT
>OriGene 3' read for NM_021637 unedited
TATGGACGCGGCCGCAATCTAGGATCGAGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCA
AATTTCAAAAAGTTTTATTTTGAAAGAATGAGAGAAATAAAACAGAGAGGTTTCAATTAC
CAAAAACAATTACACTGAAAAAAACACAATAATAAGTACTTTTCCCACACAACCCCCCCC
ATTTCCCCATCCCTGGCACAATAATATTAAAACCACCAAAGCACACCTAACAAGGAAAAA
CAACAGTACGTAATGAAAAAAGCAAATGTCCATACTGCTCAGTCCAACTAACCCTTATGA
AATGTCCTTCCCCCAGCTAAACCCTACCCACTGGAATGATAAAAAAATGTAAAGACAACC
CTAGGGGAAACTTGGAACTCTGCTTATACTAGCAAAGCTCAGTGAAAAATCAGTAAAAGT
AGTGAATCTGTTTGGCAGTGAAACACTGGATATAGCTTCTTTTTCAAATTTTGGATGATT
GCAAAAAACAGGTAAAGTTTGAGGCTCACAGACTTCTAACAGGACTGATCCCTGTTCCCT
CAACCGTAACAGTGGAGCAGCTGCCAAATCCTGGTTGGCTGCTGAAAATAGTGGAAGTGA
GGCAACTTTGGGCTTAAGACAATCTGAAAAAGATGTCTGGAAACAAGTTTACTGCTTCAG
TTTCAAACTGTGAGTAAAGGGTTTTAATAGGTGGGGCTTGGACAAAGGCAGGTTGAAACT
TCCATATTATCACTTGAAGAATTAAACTATCAATTTGACTGCATGCATCCCCTTGTTTTA
AATAAATTCAATATGGGACTATTTAAAAATGTAAACNAACTGTTGGNACTAGAGCCTAAT
TAAATTCATATANTAACTCANTGTCCGAAAATGAATGTTTTTTTTTTTTCTCCTAAGTAA
TAAAGTTTAGNTTGTAGTATCTGGTGGAAAGATT
Restriction Sites NotI-NotI     
ACCN NM_021637
Insert Size 2470 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_021637.1, NP_067650.1
RefSeq Size 2039 bp
RefSeq ORF 504 bp
Locus ID 59353
UniProt ID Q53FP2
Cytogenetics Xq22.1
Protein Families Transmembrane
Gene Summary A soluble peptide released by shedding may interact with NGFR and modulate neurite outgrowth.[UniProtKB/Swiss-Prot Function]

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.