ACKR3 (NM_020311) Human Untagged Clone

CAT#: SC112665

CXCR7 (untagged)-Human chemokine (C-X-C motif) receptor 7 (CXCR7)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name ACKR3 (NM_020311) Human Untagged Clone
Symbol ACKR3
Synonyms CMKOR1; CXC-R7; CXCR-7; CXCR7; GPR159; RDC-1; RDC1
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC112665 sequence for NM_020311 edited (data generated by NextGen Sequencing)
ATGGATCTGCATCTCTTCGACTACTCAGAGCCAGGGAACTTCTCGGACATCAGCTGGCCA
TGCAACAGCAGCGACTGCATCGTGGTGGACACGGTGATGTGTCCCAACATGCCCAACAAA
AGCGTCCTGCTCTACACGCTCTCCTTCATTTACATTTTCATTTTCGTCATCGGCATGATT
GCCAACTCCGTGGTGGTCTGGGTGAATATCCAGGCCAAGACCACAGGCTATGACACGCAC
TGCTACATCTTGAACCTGGCCATTGCCGACCTGTGGGTTGTCCTCACCATCCCAGTCTGG
GTGGTCAGTCTCGTGCAGCACAACCAGTGGCCCATGGGCGAGCTCACGTGCAAAGTCACA
CACCTCATCTTCTCCATCAACCTCTTCGGCAGCATTTTCTTCCTCACGTGCATGAGCGTG
GACCGCTACCTCTCCATCACCTACTTCACCAACACCCCCAGCAGCAGGAAGAAGATGGTA
CGCCGTGTCGTCTGCATCCTGGTGTGGCTGCTGGCCTTCTGCGTGTCTCTGCCTGACACC
TACTACCTGAAGACCGTCACGTCTGCGTCCAACAATGAGACCTACTGCCGGTCCTTCTAC
CCCGAGCACAGCATCAAGGAGTGGCTGATCGGCATGGAGCTGGTCTCCGTTGTCTTGGGC
TTTGCCGTTCCCTTCTCCATTATCGCTGTCTTCTACTTCCTGCTGGCCAGAGCCATCTCG
GCGTCCAGTGACCAGGAGAAGCACAGCAGCCGGAAGATCATCTTCTCCTACGTGGTGGTC
TTCCTTGTCTGCTGGCTGCCCTACCACGTGGCGGTGCTGCTGGACATCTTCTCCATCCTG
CACTACATCCCTTTCACCTGCCGGCTGGAGCACGCCCTCTTCACGGCCCTGCATGTCACA
CAGTGCCTGTCGCTGGTGCACTGCTGCGTCAACCCTGTCCTCTACAGCTTCATCAATCGC
AACTACAGGTACGAGCTGATGAAGGCCTTCATCTTCAAGTACTCGGCCAAAACAGGGCTC
ACCAAGCTCATCGATGCCTCCAGAGTCTCAGAGACGGAGTACTCTGCCTTGGAGCAGAGC
ACCAAATGA

Clone variation with respect to NM_020311.2
162 c=>t
5' Read Nucleotide Sequence
>OriGene 5' read for NM_020311 unedited
NTTGTCAAAATTTGTATACGACTCACTATAGGCGGCCGCGAATTCGCACGAGGAAGGGAG
CCAGCGCACAGCACAGCCAGGAAGGCGAGCGAGCCCAGCCAGCCCAGCCAGCCCAGCCAG
CCCGGAGGTCATTTGATTGCCCGCCTCAGAACGATGGATCTGCATCTCTTCGACTACTCA
GAGCCAGGGAACTTCTCGGACATCAGCTGGCCATGCAACAGCAGCGACTGCATCGTGGTG
GACACGGTGATGTGTCCCAACATGCCCAACAAAAGCGTCCTGCTCTACACGCTCTCCTTC
ATTTACATTTTCATTTTCGTCATCGGCATGATTGCCAACTCCGTGGTGGTCTGGGTGAAT
ATCCAGGCCAAGACCACAGGCTATGACACGCACTGCTACATCTTGAACCTGGCCATTGCC
GACCTGTGGGTTGTCCTCACCATCCCAGTCTGGGTGGTCAGTCTCGTGCAGCACAACCAG
TGGCCCATGGGCGAGCTCACGTGCAAAGTCACACACCTCATCTTCTCCATCAACCTCTTC
GGCAGCATTTTCTTCCTCACGTGCATGAGCGTGGACCGCTACCTCTCCATCACCTACTTC
ACCAACACCCCCAGCAGCAGGAAGAAGATGGTACGCCGTGTCGTCTGCATCCTGGTGTGG
CTGCTGGCCTTCTGCGTGTCTCTGCCTGACACCTACTACCTGAAGACCGTCACGTCTGCG
TCCAACAATGAGACCTACTGCCGGTCCTTCTACCCCGAGCACAGCATCAAGGAGTGGCTG
ATCGGCATGGAGCTGGTCTNCGTTGTCTTGGGCTNTGCCGTTCCCTTCTNCTTATCGCTG
TCTTCTACTTNCTGCTGGCCAGAGCCATCTCGCGTCCAGTGACCCAGAGAGCACAGCAGC
CGGAGACATCTCNTCTACGTGGTGGGCTTCCTTG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_020311 unedited
CCTTTTTAACTATGNACCGCGGCNCGTATTCTCATGATCGGTCCTTTTTTTTTTTTTTTT
AGGAAACAAAAATTTTTATTAAAAAACTTCACTTACACATTGCGTAGAATATCTGAAATG
CAACTGCTCGTTGCGTGTGCAGATCCGTAGTTTCAGCAACAGCCCCCCCCGCGATCGCTA
AATGTACCTTTACACTACTATTAATGTGACAAACTGCATTACACAGCAGTTCTCGCTTCA
TATCCCGCGCCGGTACAACCCACCACACATCTTTTCAACCATGGTCCATAACACATCGCA
GCCTCCCACTGCTATCCATCTCCCTCCTCCCTTACTCCCACTCCTACCTCCTTGTTCCCC
TCCTCTCTCGTCTCTGTCATTCTTCCCCCCATTTCCACGTTTTGCCCACCCTCAAAACCA
CACCCACTCTGAATATATGCTAGCATTTATGTCTGTGTTACAATACCCACCATATAGTTA
CACCCCCCACTCCTCTCACCAGGCCCACCTATTCTGCATAACTACCGCGCTCATCCCTAC
TCCCTTCGCCCCTCGCCAATCCTTTGCCCCCTTGACTTCCCCACCTTCCCGTATCTTCAG
TTTTCGTCTGCCCTCCCCCTCGCCTCTGACTCATTTTCTTGTCGGTGTACCCAAGCGCCG
ACTGCCGATAACCTGTCGCGCCGTTAAGTCCAATGTAAGCCTGGGCCCTTCCAAAACGTA
AGTACGTTCGCACCCCCCCCCCGTCGCCCTTACCTTCACGCGGCCTGAACTATGGGGGCA
CTTCGTTTGTCTTATTCCCCCCCGGCTTCTTCCGTGCTTGTACCCAACCATACTTTCCTT
TATTTTCTTTCGCATTACCATCCGGGGCCTGTTCCAGTTTCCACCCCCCTCCTTTCAACC
TGTAG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_020311
ORF Size 1089 bp
Insert Size 2090
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_020311.1, NP_064707
RefSeq Size 2064
Locus ID 57007
Cytogenetics 2q37.3
Protein Families GPCR, Transmembrane, Druggable Genome
Gene Summary This gene encodes a member of the G-protein coupled receptor family. Although this protein was earlier thought to be a receptor for vasoactive intestinal peptide (VIP), it is now considered to be an orphan receptor, in that its endogenous ligand has not been identified. The protein is also a coreceptor for human immunodeficiency viruses (HIV). Translocations involving this gene and HMGA2 on chromosome 12 have been observed in lipomas. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations