DLL3 (NM_016941) Human Untagged Clone

CAT#: SC111951

DLL3 (untagged)-Human delta-like 3 (Drosophila) (DLL3), transcript variant 1

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name DLL3 (NM_016941) Human Untagged Clone
Symbol DLL3
Synonyms SCDO1; SCDO1
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_016941 edited
GAATTCGGCACGAGGCCAGAAGGCCATGGTCTCCCCACGGATGTCCGGGCTCCTCTCCCA
GACTGTGATCCTAGCGCTCATTTTCCTCCCCCAGACACGGCCCGCTGGCGTCTTCGAGCT
GCAGATCCACTCTTTCGGGCCGGGTCCAGGCCCTGGGGCCCCGCGGTCCCCCTGCAGCGC
CCGGCTCCCCTGCCGCCTCTTCTTCAGAGTCTGCCTGAAGCCTGGGCTCTCAGAGGAGGC
CGCCGAGTCCCCGTGCGCCCTGGGCGCGGCGCTGAGTGCGCGCGGACCGGTCTACACCGA
GCAGCCCGGAGCGCCCGCGCCTGATCTCCCACTGCCCGACGGCCTCTTGCAGGTGCCCTT
CCGGGACGCCTGGCCTGGCACCTTCTCTTTCATCATCGAAACCTGGAGAGAGGAGTTAGG
AGACCAGATTGGAGGGCCCGCCTGGAGCCTGCTGGCGCGCGTGGCTGGCAGGCGGCGCTT
GGCAGCCGGAGGCCCGTGGGCCCGGGACATTCAGCGCGCAGGCGCCTGGGAGCTGCGCTT
CTCGTACCGCGCGCGCTGCGAGCCGCCTGCCGTCGGGACCGCGTGCACGCGCCTCTGCCG
TCCGCGCAGCGCCCCCTCGCGGTGCGGTCCGGGACTGCGCCCCTGCGCACCGCTCGAGGA
CGAATGTGAGGCGCCGCCGGTGTGCCGAGCAGGCTGCAGCCCTGAGCATGGCTTCTGTGA
ACAGCCCGGTGAATGCCGATGCCTAGAGGGCTGGACTGGACCCCTCTGCACGGTCCCTGT
CTCCACCAGCAGCTGCCTCAGCCCCAGGGGCCCGTCCTCTGCTACCACCGGATGCCTTGT
CCCTGGGCCTGGGCCCTGTGACGGGAACCCGTGTGCCAATGGAGGCAGCTGTAGTGAGAC
ACCCAGGTCCTTTGAATGCACCTGCCCGCGTGGGTTCTACGGGCTGCGGTGTGAGGTGAG
CGGGGTGACATGTGCAGATGGACCCTGCTTCAACGGCGGCTTGTGTGTCGGGGGTGCAGA
CCCTGACTCTGCCTACATCTGCCACTGCCCACCCGGTTTCCAAGGCTCCAACTGTGAGAA
GAGGGTGGACCGGTGCAGCCTGCAGCCATGCCGCAATGGCGGACTCTGCCTGGACCTGGG
CCACGCCCTGCGCTGCCGCTGCCGCGCCGGCTTCGCGGGTCCTCGCTGCGAGCACGACCT
GGACGACTGCGCGGGCCGCGCCTGCGCTAACGGCGGCACGTGTGTGGAGGGCGGCGGCGC
GCACCGCTGCTCCTGCGCGCTGGGCTTCGGCGGCCGCGACTGCCGCGAGCGCGCGGACCC
GTGCGCCGCGCGCCCCTGTGCTCACGGCGGCCGCTGCTACGCCCACTTCTCCGGCCTCGT
CTGCGCTTGCGCTCCCGGCTACATGGGAGCGCGGTGTGAGTTCCCAGTGCACCCCGACGG
CGCAAGCGCCTTGCCCGCGGCCCCGCCGGGCCTCAGGCCCGGGGACCCTCAGCGCTACCT
TTTGCCTCCGGCTCTGGGACTGCTCGTGGCCGCGGGCGTGGCCGGCGCTGCGCTCTTGCT
GGTCCACGTGCGCCGCCGTGGCCACTCCCAGGATGCTGGGTCTCGCTTGCTGGCTGGGAC
CCCGGAGCCGTCAGTCCACGCACTCCCGGATGCACTCAACAACCTAAGGACGCAGGAGGG
TTCCGGGGATGGTCCGAGCTCGTCCGTAGATTGGAATCGCCCTGAAGATGTAGACCCTCA
AGGGATTTATGTCATATCTGCTCCTTCCATCTACGCTCGGGAGGTAGCGACGCCCCTTTT
CCCCCCGCTACACACTGGGCGCGCTGGGCAGAGGCAGCACCTGCTTTTTCCCTACCCTTC
CTCGATTCTGTCCGTGAAATGAATTGGGTAGAGTCTCTGGAAGGTTTTAAGCCCATTTTC
AGTTCTAACTTACTTTCATCCTATTTTGCATCCCTCTTATCGTTTTGAGCTACCTGCCAT
CTTCTCTTTGAAAAACCTATGGGCTTGAGGAGGTCACGATGCCGACTCCGCCAGAGCTTT
TCCACTGATTGTACTCAGCGGGGAGGCAGGGGAGGCAGAGGGGCAGCCTCTCTAATGCTT
CCTACTCATTTTGTTTCTAGGCCTGACGCGTCTCCTCCATCCGCACCTGGAGTCAGAGCG
TGGATTTTTGTATTTGCTCGGTGGTGCCCAGTCTCTGCCCCAGAGGCTTTGGAGTTCAAT
CTTGAAGGGGTGTCTGGGGGAACTTTACTGTTGCAAGTTGTAAATAATGGTTATTTATAT
CCTATTTTTTCTCACCCCATCTCTCTAGAAACACCTATAAAGGCTATTATTGTGATCAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACTCGAC
5' Read Nucleotide Sequence
>OriGene 5' read for NM_016941 unedited
CAAAATTTGTATACGACTACTATAGGGCGGCCGCGAATTCGGCACGAGCCANAAGCCATG
GTCTCCCCACGGATGTCCGGGCTCCTCTCCCAGACTGTGATCCTAGCGCTCATTTTCCTC
CCCCAGACACGGCCCGCTGGCGTCTTCGAGCTGCAGATCCACTCTTTCGGGCCGGGTCCA
GGCCCTGGGGCCCCGCGGTCCCCCTGCAGCGCCCGGCTCCCCTGCCGCCTCTTCTTCAGA
GTCTGCCTGAAGCCTGGGCTCTCAGAGGAGGCCGCCGAGTCCCCGTGCGCCCTGGGCGCG
GCGCTGAGTGCGCGCGGACCGGTCTACACCGAGCAGCCCGGAGCGCCCGCGCCTGATCTC
CCACTGCCCGACGGCCTCTTGCAGGTGCCCTTCCGGGACGCCTGGCCTGGCACCTTCTCT
TTCATCATCGAAACCTGGAGAGAGGAGTTAGGAGACCAGATTGGAGGGCCCGCCTGGAGC
CTGCTGGCGCGCGTGGCTGGCAGGCGGCGCTTGGCAGCCGGAGGCCCGTGGGCCCGGGAC
ATTCAGCGCGCAGGCGCCTGGGAGCTGCGCTTCTCGTACCGCGCGCGCTGCGAGCCGCCT
GCCGTCGGGACCGCGTGCACGCGCCTCTGCCGTCCGCGCAGCGCCCCCTCGCGGTGCGGT
CCGGGACTGCGCCCCTGCGCNACCGCTCGAGACGAATGTGAGGCGCCGCCGGTGTGCCGN
AGCAGCTGCAGCCCTGAGCATGGCTTCTGTGAACAGCCCCGGGGATGCCCGATGCCTANA
GGGGCTGACTGGACCCCTCTGGACGGNTCCTGGTTCCCCAGCAGTTGCCTCAGCCCCAGG
GCCCGTCCTTTGCTACCACCGGAGCCTTGTCCTGGGCCTTGGCCCTGGAACGGAACCCCG
GTGCCATGGAGGCANCTGTATGGAGACACCCAGTCTTTGTATGCACTGCC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_016941 unedited
AAGGTGAGGGGGNCCAAACCAGGNGTGGTCGGCGGGTAGGGCGTGTAGCAAAAATAGGGA
GTAAATAACCATTAGGTACAACTTGCAGCAGGGAAGTTCGGCCAGACACCCCGTCAAGAT
TGAACTCCAAAGCCTCTGGGGCAGAGACTGGGCACCACCGAGCAAATACAAAAATCCACG
CTCTGACTCCAGGTGCGGATGGAGGAGACGCGTCAGGCCTAGAAACAAAATGAGTAGGAA
GCATTAGAGAGGCTGCCCCTCTGCCTCCCCTGCCTCCCCGCTGAGTACAATCAGTGGAAA
AGCTCTGGCGGAGTCGGCATCGTGACCTCCTCAAGCCCATAGGTTTTTCAAAGAGAAGAT
GGCAGGTAGCTCAAAACGATAAGAGGGATGCAAACTAGGATGAAAGTTACCTATAACTGA
GAATGGGCTTAAGACCTTCCAGAGACTCTACCCAATTCATTTCACGGACAGAACCGTCGA
AGGGTCCGGAAACAGCAGGTGCTGCCTTCTGCCATCGCGCCCAGAGTGTATCGCTGGGAA
AAGGCGCCGCTCCCCCTGCCCGAGCGTAGCTGGTAGGAGCCGACTTGACATAAATCCCTT
GAGGGCCTACATACTGCGGGGTGATTCCAGTCTACGGCACACCCTGGACCCTTCCCGGAA
CCCTCCGGTGTCCTTAGGCTGGTGGGCGCATCCCGCAGGGCGTGGAATGATTGTCTCCCG
GGCCCCCCCCCGCTTTGCCATTCCCCCATCCCTCGGCCTGGCTCACCGGCGGGCCCCGTT
GCACCCGCCAGGAGTGCCACTGCCTGTCTCACCCCCGGTCGTCCCCTATGCTCTTTCCTC
CTTCTGTGGGCTTTAAGCGGGGATCGTCCGTGCGCGCCCGGACTCACGACGCTCCGTCGA
TGCCCCCGGCCTCCACGAAGCCTCTGTTCCGCTCGTCGCGCCCACGGGCGTCCTTCTACA
GCGCGTTCCCTACGACACCAATAC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_016941
ORF Size 1857 bp
Insert Size 2370
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_016941.2, NP_058637
RefSeq Size 2359
Locus ID 10683
Cytogenetics 19q13.2
Domains EGF_CA, EGF, EGF
Protein Families Stem cell relevant signaling - DSL/Notch pathway, ES Cell Differentiation/IPS, Transmembrane, Cancer stem cells, Druggable Genome
Protein Pathways Notch signaling pathway
Gene Summary This gene encodes a member of the delta protein ligand family. This family functions as Notch ligands that are characterized by a DSL domain, EGF repeats, and a transmembrane domain. Mutations in this gene cause autosomal recessive spondylocostal dysostosis 1. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations