DNMT3B (NM_006892) Human Untagged Clone

CAT#: SC111622

DNMT3B (untagged)-Human DNA (cytosine-5-)-methyltransferase 3 beta (DNMT3B), transcript variant 1

USD 1,638


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name DNMT3B (NM_006892) Human Untagged Clone
Symbol DNMT3B
Synonyms ICF; ICF1; M.HsaIIIB
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_006892 edited
ATGAAGGGAGACACCAGGCATCTCAATGGAGAGGAGGACGCCGGCGGGAGGGAAGACTCG
ATCCTCGTCAACGGGGCCTGCAGCGACCAGTCCTCCGACTCGCCCCCAATCCTGGAGGCT
ATCCGCACCCCGGAGATCAGAGGCCGAAGATCAAGCTCGCGACTCTCCAAGAGGGAGGTG
TCCAGTCTGCTAAGCTACACACAGGACTTGACAGGCGATGGCGACGGGGAAGATGGGGAT
GGCTCTGACACCCCAGTCATGCCAAAGCTCTTCCGGGAAACCAGGACTCGTTCAGAAAGC
CCAGCTGTCCGAACTCGAAATAACAACAGTGTCTCCAGCCGGGAGAGGCACAGGCCTTCC
CCACGTTCCACCCGAGGCCGGCAGGGCCGCAACCATGTGGACGAGTCCCCCGTGGAGTTC
CCGGCTACCAGGTCCCTGAGACGGCGGGCAACAGCATCGGCAGGAACGCCATGGCCGTCC
CCTCCCAGCTCTTACCTTACCATCGACCTCACAGACGACACAGAGGACACACATGGGACG
CCCCAGAGCAGCAGTACCCCCTACGCCCGCCTAGCCCAGGACAGCCAGCAGGGGGGCATG
GAGTCCCCGCAGGTGGAGGCAGACAGTGGAGATGGAGACAGTTCAGAGTATCAGGATGGG
AAGGAGTTTGGAATAGGGGACCTCGTGTGGGGAAAGATCAAGGGCTTCTCCTGGTGGCCC
GCCATGGTGGTGTCTTGGAAGGCCACCTCCAAGCGACAGGCTATGTCTGGCATGCGGTGG
GTCCAGTGGTTTGGCGATGGCAAGTTCTCCGAGGTCTCTGCAGACAAACTGGTGGCACTG
GGGCTGTTCAGCCAGCACTTTAATTTGGCCACCTTCAATAAGCTCGTCTCCTATCGAAAA
GCCATGTACCATGCTCTGGAGAAAGCTAGGGTGCGAGCTGGCAAGACCTTCCCCAGCAGC
CCTGGAGACTCATTGGAGGACCAGCTGAAGCCCATGTTGGAGTGGGCCCACGGGGGCTTC
AAGCCCACTGGGATCGAGGGCCTCAAACCCAACAACACGCAACCAGAGAACAAGACTCGA
AGACGCACAGCTGACGACTCAGCCACCTCTGACTACTGCCCCGCACCCAAGCGCCTCAAG
ACAAATTGCTATAACAACGGCAAAGACCGAGGGGATGAAGATCAGAGCCGAGAACAAATG
GCTTCAGATGTTGCCAACAACAAGAGCAGCCTGGAAGATGGCTGTTTGTCTTGTGGCAGG
AAAAACCCCGTGTCCTTCCACCCTCTCTTTGAGGGGGGGCTCTGTCAGACATGCCGGGAT
CGCTTCCTTGAGCTGTTTTACATGTATGATGACGATGGCTATCAGTCTTACTGCACTGTG
TGCTGCGAGGGCCGAGAGCTGCTGCTTTGCAGCAACACGAGCTGCTGCCGGTGTTTCTGT
GTGGAGTGCCTGGAGGTGCTGGTGGGCACAGGCACAGCGGCCGAGGCCAAGCTTCAGGAG
CCCTGGAGCTGCTACATGTGTCTCCCGCAGCGCTGTCATGGCGTCCTGCGGCGCCGGAAG
GACTGGAACGTGCGCCTGCAGGCCTTCTTCACCAGTGACACGGGGCTTGAATACGAAGCC
CCCAAGCTGTACCCTGCCATTCCCGCAGCCCGAAGGCGGCCCATTCGAGTCCTGTCATTG
TTTGATGGCATCGCGACAGGCTACCTAGTCCTCAAAGAGTTGGGCATAAAGGTAGGAAAG
TACGTCGCTTCTGAAGTGTGTGAGGAGTCCATTGCTGTTGGAACCGTGAAGCACGAGGGG
AATATCAAATACGTGAACGACGTGAGGAACATCACAAAGAAAAATATTGAAGAATGGGGC
CCATTTGACTTGGTGATTGGCGGAAGCCCATGCAACGATCTCTCAAATGTGAATCCAGCC
AGGAAAGGCCTGTATGAGGGTACAGGCCGGCTCTTCTTCGAATTTTACCACCTGCTGAAT
TACTCACGCCCCAAGGAGGGTGATGACCGGCCGTTCTTCTGGATGTTTGAGAATGTTGTA
GCCATGAAGGTTGGCGACAAGAGGGACATCTCACGGTTCCTGGAGTGTAATCCAGTGATG
ATTGATGCCATCAAAGTTTCTGCTGCTCACAGGGCCCGATACTTCTGGGGCAACCTACCC
GGGATGAACAGGATCTTTGGCTTTCCTGTGCACTACACAGACGTGTCCAACATGGGCCGT
GGTGCCCGCCAGAAGCTGCTGGGAAGGTCCTGGAGCGTGCCTGTCATCCGACACCTCTTC
GCCCCTCTGAAGGACTACTTTGCATGTGAATAG
5' Read Nucleotide Sequence
>OriGene 5' read for NM_006892 unedited
GCATATGTAATACGACTCACTATAGGGCGGCCGCGATTCGGCACGAGGCCGACCCGCGGC
TCCGCCGCCCAGCCGCGCCCCAGCCAGCCCTGCGGCAGGAAAGCATGAAGGGAGACACCA
GGCATCTCAATGGAGAGGAGGACGCCGGCGGGAGGGAAGACTCGATCCTCGTCAACGGGG
CCTGCAGCGACCAGTCCTCCGACTCGCCCCCAATCCTGGAGGCTATCCGCACCCCGGAGA
TCAGAGGCCGAAGATCAAGCTCGCGACTCTCCAAGAGGGAGGTGTCCAGTCTGCTAAGCT
ACACACAGGACTTGACAGGCGATGGCGACGGGGAAGATGGGGATGGCTCTGACACCCCAG
TCATGCCAAAGCTCTTCCGGGAAACCAGGACTCGTTCAGAAAGCCCAGCTGTCCGAACTC
GAAATAACAACAGTGTCTCCAGCCGGGAGAGGCACAGGCCTTCCCCACGTTCCACCCGAG
GCCGGCAGGGCCGCAACCATGTGGACGAGTCCCCCGTGGAGTTCCCGGCTACCAGGTCCC
TGAGACGGCGGGCAACAGCATCGGCAGGAACGCCATGGCCGTCCCCTCCCAGCTCTTACC
TTACCATCGACCTCACAGACGACACAGAGGACACACATGGGACGCCCCAGAGCAGCAGTA
CCCCCTACGCCCGCCTAGCCCAGGACAGCCAGCAGGGGGGCATGGAGTCCCCGCAGGTGG
AGGCAGACAGTGGAGATGGAGACAGTTCAGAGTATCAGGATGGGAAGGAGTTTGGAATAG
GGGACCTCGTGTGGGGAAAGATCAAGGGCTTCTCCTGGTGGCCCGCATGGTGGTGTCTTG
GAAGGCCACCTNCAGCGACAGGCTATGTCTGCATGNCGTGGTTCAGTGGTTTGGCGATGG
GCAGTCTNCGAGGTCTCTGAGACAACTGGTGACTTGGGGCTGTTCACCAGCACTTTATTN
GGCCACTTTCATAGCT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_006892 unedited
ACGACTNTGNNACCGCGGCCGCATNCTANGATCGAGTTTTTTTTTTTTTTTTTTAGACAA
ATACTGATTTTAATTAAACATAAGGTAAACTCTAGGCATCCGTCATCTTTCAGCCTAAAA
ATTAGCAAAAACTGTTGAAACAAGGCACAGTTTTTTCCCCATATTTGTTACGTCGTGGCT
CCAGTTACAAAAAAATTTTAATGAAAACGTTAAACATAAAAATAGAAGTTTGAGATTTTA
AAAAGTGTATAAAAAGCCCCACAAAACTTGTCAACGTTGTTCCTTATTCTACAAAATAGC
ACCAGTAAGAAGAGTAAAAGGTGTTAAAAACCATTATGACAGCATTTCTGAAATGCAGCT
TGTCTGAATTCCCGTTCTCCCTAAAAACGACTTCTTATGGAATAAAAAAGGATTAAAAAA
TCTCCAAAGGGAGCACCGAGCTTTGCAGTTTTCCCTGTCATCTCTCAGATGTGGGGAAGG
TATGAGAAATGTATGTCTGTCCCTGACTGCTGTCACTGCCTCTGAGTTTAGTAAAAAGAT
GAGAAATGAGGGTAGCAGACTTCTCATCTGGGGACCTGTGCCTGTGGAGGGTAGGTCTCC
TGGAGAGGGAATGGGTTTGAGGGGGTGTCTTATCTAAGCTCCTTGCTTCACACTCCTCTC
CTAGGGAAGAGGGAGATACGGAGGAGCCATACTTGTCTACAAAATATATGGCAGCTTATA
TTATAGAACTCAGCACACCCCTTCCTGAGCTCCCCAGAGGGTTCTATTGCAGTCACGGGG
AGGGATTTAGCTAACAGTGGCCCCTGCCTTAGGGTTTGTGGGGGAAAAAATAGCCCTGAT
GTGATGATGACGTCATCCCTGCTGAAATATCATCATTGTGGAAATACTCTATAAGTCCCG
TGCAGACTCCAGCCCTGNATTTATGCANGNGCAATGTGCCTGGTAAAGACAN
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_006892
ORF Size 2562 bp
Insert Size 3800
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_006892.3, NP_008823
RefSeq Size 4353
RefSeq ORF 2562
Locus ID 1789
Cytogenetics 20q11.21
Domains PWWP, DNA_methylase
Protein Families Stem cell - Pluripotency, Embryonic stem cells, Induced pluripotent stem cells, Druggable Genome
Protein Pathways Cysteine and methionine metabolism, Metabolic pathways
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations