SOCS1 (NM_003745) Human Untagged Clone

CAT#: SC111081

SOCS1 (untagged)-Human suppressor of cytokine signaling 1 (SOCS1)

USD 402.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name SOCS1 (NM_003745) Human Untagged Clone
Symbol SOCS1
Synonyms CIS1; CISH1; JAB; SOCS-1; SSI-1; SSI1; TIP3
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_003745 edited
ATCGGCACCAGGGCAGCTGCACGGCTCCTGGCCCCGGAGCATGCGCGAGAGCCGCCCCGG
AGCGCCCCGGAGCCCCCCGCCGTCCCGCCCGCGGCGTCCCGCGCCCCGCCGCCAGCGCAC
CCCCGGACGCTATGGCCCACCCCTCCGGCTGGCCCCTTCTGTAGGATGGTAGCACACAAC
CAGGTGGCAGCCGACAATGCAGTCTCCACAGCAGCAGAGCCCCGACGGCGGCCAGAACCT
TCCTCCTCTTCCTCCTCCTCGCCCGCGGCCCCCGCGCGCCCGCGGCCGTGCCCCGCGGTC
CCGGCCCCGGCCCCCGGCGACACGCACTTCCGCACATTCCGTTCGCACGCCGATTACCGG
CGCATCACGCGCGCCAGCGCGCTCCTGGACGCCTGCGGATTCTACTGGGGGCCCCTGAGC
GTGCACGGGGCGCACGAGCGGCTGCGCGCCGAGCCCGTGGGCACCTTCCTGGTGCGCGAC
AGCCGCCAGCGGAACTGCTTTTTCGCCCTTAGCGTGAAGATGGCCTCGGGACCCACGAGC
ATCCGCGTGCACTTTCAGGCCGGCCGCTTTCACCTGGATGGCAGCCGCGAGAGCTTCGAC
TGCCTCTTCGAGCTGCTGGAGCACTACGTGGCGGCGCCGCGCCGCATGCTGGGGGCCCCG
CTGCGCCAGCGCCGCGTGCGGCCGCTGCAGGAGCTGTGCCGCCAGCGCATCGTGGCCACC
GTGGGCCGCGAGAACCTGGCTCGCATCCCCCTCAACCCCGTCCTCCGCGACTACCTGAGC
TCCTTCCCCTTCCAGATTTGACCGGCAGCGCCCGCCGTGCACGCAGCATTAACTGGGATG
CCGTGTTATTTTGTTATTACTTGCCTGGAACCATGTGGGTACCCTCCCCGGCCTGGGTTG
GAGGGAGCGGATGGGTGTAGGGGCGAGGCGCCTCCCGCCCTCGGCTGGAGACGAGGCCGC
AGACCCCTTCTCACCTCTTGAGGGGGTCCTCCCCCTCCTGGTGCTCCCTCTGGGTCCCCC
TGGTTGTTGTAGCAGCTTAACTGTATCTGGAGCCAGGACCTGAACTCGCACCTCCTACCT
CTTCATGTTTACATATACCCAGTATCTTTGCACAAACCAGGGGTTGGGGGAGGGTCTCTG
GCTTTATTTTTCTGCTGTGCAGAATCCTATTTTATATTTTTTAAAGTCAGTTTAGGTAAT
AAACTTTATTATGAAAGTTTTTTTTTTAAAAAAAAAAAAAAAAAAC
5' Read Nucleotide Sequence
>OriGene 5' read for NM_003745 unedited
GTTCAAATTTTGTAATACGAACTCACTATAGGGCGGCCGCGAATCGGCACCAGGGCAGCT
GCACGGCTCCTGGCCCCGGNACATGCGCGAGAGCCGCCCCGGAGCGCCCCGGAGCCCCCC
GCCGTCCCGCCCGCGGCGTCCCGCGCCCCGCCGCCAGCGCACCCCCGGACGCTATGGCCC
ACCCCTCCGGCTGGCCCCTTCTGTAGGATGGTAGCACACAACCAGGTGGCAGCCGACAAT
GCAGTCTCCACAGCAGCAGAGCCCCGACGGCGGCCAGAACCTTCCTCCTCTTCCTCCTCC
TCGCCCGCGGCCCCCGCGCGCCCGCGGCCGTGCCCCGCGGTCCCGGCCCCGGCCCCCGGC
GACACGCACTTCCGCACATTCCGTTCGCACGCCGATTACCGGCGCATCACGCGCGCCAGC
GCGCTCCTGGACGCCTGCGGATTCTACTGGGGGCCCCTGAGCGTGCACGGGGCGCACGAG
CGGCTGCGCGCCGAGCCCGTGGGCACCTTCCTGGTGCGCGACAGCCGCCAGCGGAACTGC
TTTTTCGCCCTTAGCGTGAAGATGGCCTCGGGACCCACGAGCATCCGCGTGCACTNTCAG
GCCGGCCGCTTTCACCTGGATGGCAGCCGCGAGAGCTTCGACTGCCTCTTCGAGCTGCTG
GAGCACTACGTGGCGGCGCCGCGCCGCATGCTGNGGGCCCCCGCTGCGCCAGCGCCGCGT
GCGGCCGCTGCNAGAGCTGTGCCGCCAGCGCATCGTGGCCCACCGTGGGCCGCGAGAACC
TGGCTCGCATCCNCCTCAAACCCGTNCTNCGNGACTACCTGAGCTNCTTNCCCTTNNCAG
ATTGACCGNCAGCGCCCGCCGTGCACGCAGCATAACTGGNATGGCGGGTNTNATTTGTAT
TACTTGCCTGGAACCCATGTGGGTACCCTCCCCGCCCTGGNNTGAGGNACGAATGNNTGT
A
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_003745
ORF Size 636 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_003745.1, NP_003736
RefSeq Size 1216
Locus ID 8651
Cytogenetics 16p13.13
Domains SH2, SOCS
Protein Families Stem cell relevant signaling - JAK/STAT signaling pathway, Stem cell - Pluripotency, Druggable Genome
Protein Pathways Ubiquitin mediated proteolysis, Jak-STAT signaling pathway, Insulin signaling pathway, Type II diabetes mellitus
Gene Summary This gene encodes a member of the STAT-induced STAT inhibitor (SSI), also known as suppressor of cytokine signaling (SOCS), family. SSI family members are cytokine-inducible negative regulators of cytokine signaling. The expression of this gene can be induced by a subset of cytokines, including IL2, IL3 erythropoietin (EPO), CSF2/GM-CSF, and interferon (IFN)-gamma. The protein encoded by this gene functions downstream of cytokine receptors, and takes part in a negative feedback loop to attenuate cytokine signaling. Knockout studies in mice suggested the role of this gene as a modulator of IFN-gamma action, which is required for normal postnatal growth and survival. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations