KGF (FGF7) (NM_002009) Human Untagged Clone

CAT#: SC110894

Reviews ()
Write a review

FGF7 (untagged)-Human fibroblast growth factor 7 (FGF7)



  "NM_002009" in other vectors (6)

Reconstitution Protocol

USD 300.00


Availability*
In Stock

Size
    • 10 ug


Product images

Other products for "FGF7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FGF7
Synonyms HBGF-7; KGF
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC110894 sequence for NM_002009 edited (data generated by NextGen Sequencing)
ATGCACAAATGGATACTGACATGGATCCTGCCAACTTTGCTCTACAGATCATGCTTTCAC
ATTATCTGTCTAGTGGGTACTATATCTTTAGCTTGCAATGACATGACTCCAGAGCAAATG
GCTACAAATGTGAACTGTTCCAGCCCTGAGCGACACACAAGAAGTTATGATTACATGGAA
GGAGGGGATATAAGAGTGAGAAGACTCTTCTGTCGAACACAGTGGTACCTGAGGATCGAT
AAAAGAGGCAAAGTAAAAGGGACCCAAGAGATGAAGAATAATTACAATATCATGGAAATC
AGGACAGTGGCAGTTGGAATTGTGGCAATCAAAGGGGTGGAAAGTGAATTCTATCTTGCA
ATGAACAAGGAAGGAAAACTCTATGCAAAGAAAGAATGCAATGAAGATTGTAACTTCAAA
GAACTAATTCTGGAAAACCATTACAACACATATGCAKCAGCTAAATGGACACACAACGGA
GGGGAAATGTTTGTKGCCTTAAATCAAAAGGGGATTCCTGTAAGAGGAAAAAAAACGAAG
AAAGAACAAAAAACAGCCCACTTTCTTCCTATGGCAATAACTTAA

Clone variation with respect to NM_002009.3
457 t=>k;495 t=>k
>OriGene 5' read for NM_002009 unedited
GTATTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGCACGCGCTCAC
ACACAGAGAGAAAATCCTTCTGCCTGTTNGATTTATGGAAACAATTATGATTCTGCTGGA
GAACTTTTCAGCTGAGAAATAGTTTGTAGCTACAGTAGAAAGGCTCAAGTTGCACCAGGC
AGACAACAGACATGGAATTCTTATATATCCAGCTGTTAGCAACAAAACAAAAGTCAAATA
GCAAACAGCGTCACAGCAACTGAACTTACTACGAACTGTTTTTATGAGGATTTATCAACA
GAGTTATTTAAGGAGGAATCCTGTGTTGTTATCAGGAACTAAAAGGATAAGGCTAACAAT
TTGGAAAGAGCAACTACTCTTTCTTAAATCAATCTACAATTCACAGATAGGAAGAGGTCA
ATGACCTAGGAGTAACAATCAACTCAAGATTCATTTTCATTATGTTATTCATGAACACCC
GGAGCACTACACTATAATGCACAAATGGATACTGACATGGATCCTGCCAACTTTGCTCTA
CAGATCATGCTTTCACATTATCTGTCTAGTGGGTACTATATCTTTAGCTTGCAATGACAT
GACTCCAGAGCAAATGGCTACAAATGTGAACTGTTCCAGCCCTGAGCGACACACAAGAAG
TTATGATTACATGGAAGGAGGGGATATAAGAGTGAGAAGACTCTTCTGTCGAACACAGTG
GTACCTGAGGATCGATAAAAGAGGCAAAGTAAAAGGGACCCAAGAGATGAAGAATAATTA
CAATATCATGGAAATCAGGACAGTGGCAGTTGGAATTGTGGCATCAAAGGGTGGAAGTGA
ATTCTATCTGCATGAACAGGNANGAAAACTCTATGCAAGAAGATGCAATGAGATTGTACT
TCAAGACTATTCTGGAAACCATTCACACTATGCTCAGCTAATGGACACACACGAGGGGAA
ATGTTGTGCCTAATAAAGGG
>OriGene 3' read for NM_002009 unedited
ATGGAACGCGGCACGCAATCTAGTATCGAGTTTTTTTTTTTTTTTTTCTAATTGTTAGAA
ACTCATGTATTTAATTTTATCTTTCAAAGAACATTTTTAAAAGGCTTACTCTGCTTATAT
GTATATTTTGCACAAAGCTTTCCATTCATAAACAAAAGGTGAATAGGAATCAGAATTGAA
AACTACATAATTTCTTTTCTCCTTTTGAGTCAAATCATCACAGTATAGATTAGTCATTGT
GTATGAAGTGCATTGCCAAGACATAGTCACATTTGTGTACAAATGTAAAGGCTATATCTC
AACAGAAATAAAAAACAAAAACATGCCAAAGACCATTAGCTAATAATACTAATAATCGAA
GAGTAGAAAGCATGTGCTAACTGATCTAGACTCTTGTGACAGCTGTATATCTACCCAGCT
GCGTGACCTTAGGTGTATCAAAATCTCAATTTCCTATACTACAAATGAGTAAGAGGGATG
GAGGCCCCTCACAGTTTTAATATTCTAGAATTCTAAAGGTGCGTAACTAGAGCAAATTTT
ATTTTCTAAATTTGCATACTAAATTTAAAATAGGAGAAAAACAAATAATTAAAGTACATA
TTTCTAGAAGTCTTTTTAGGCGACTTATACTACCAAGAATGGATTTACCACTAAATGTAG
GTTTTGCCAATTCCAACTTTGCTATGTACTCTGATGGAAGATAACTCCATAGACAAAGAC
ATTTGGCCCAAACTAACTTGAATTTATATGCATATACACTATTCCTATTAAATTCCCGGA
TAGACAAGTCTAACCCTTTAAAAGAAAAATAACCTAAAGGGAATTTCCTTTGGCTATAAA
CTTCAGGGAATCCCCTGGAAACCGTTTATAAACAAACGCCGCTAGGCCTAAGGAACCCAC
TGAAAACTATTCCCCCCCCGCCCCATATCCACAAAATAACTTCTTAACCCGACCTAAACA
TATAGCA
Restriction Sites NotI-NotI     
ACCN NM_002009
Insert Size 3800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002009.2, NP_002000.1
RefSeq Size 3853 bp
RefSeq ORF 585 bp
Locus ID 2252
UniProt ID P21781
Cytogenetics 15q21.2
Domains FGF
Protein Families Adult stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Secreted Protein
Protein Pathways MAPK signaling pathway, Melanoma, Pathways in cancer, Regulation of actin cytoskeleton
Gene Summary The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein is a potent epithelial cell-specific growth factor, whose mitogenic activity is predominantly exhibited in keratinocytes but not in fibroblasts and endothelial cells. Studies of mouse and rat homologs of this gene implicated roles in morphogenesis of epithelium, reepithelialization of wounds, hair development and early lung organogenesis. [provided by RefSeq, Jul 2008]

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.