AKT3 (NM_005465) Human Untagged Clone

CAT#: SC110105

AKT3 (untagged)-Human v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) (AKT3), transcript variant 1

USD 763.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name AKT3 (NM_005465) Human Untagged Clone
Symbol AKT3
Synonyms MPPH; MPPH2; PKB-GAMMA; PKBG; PRKBG; RAC-gamma; RAC-PK-gamma; STK-2
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_005465 edited
ATGAGCGATGTTACCATTGTGAAAGAAGGTTGGGTTCAGAAGAGGGGAGAATATATAAAA
AACTGGAGGCCAAGATACTTCCTTTTGAAGACAGATGGCTCATTCATAGGATATAAAGAG
AAACCTCAAGATGTGGATTTACCTTATCCCCTCAACAACTTTTCAGTGGCAAAATGCCAG
TTAATGAAAACAGAACGACCAAAGCCAAACACATTTATAATCAGATGTCTCCAGTGGACT
ACTGTTATAGAGAGAACATTTCATGTAGATACTCCAGAGGAAAGGGAAGAATGGACAGAA
GCTATCCAGGCTGTAGCAGACAGACTGCAGAGGCAAGAAGAGGAGAGAATGAATTGTAGT
CCAACTTCACAAATTGATAATATAGGAGAGGAAGAGATGGATGCCTCTACAACCCATCAT
AAAAGAAAGACAATGAATGATTTTGACTATTTGAAACTACTAGGTAAAGGCACTTTTGGG
AAAGTTATTTTGGTTCGAGAGAAGGCAAGTGGAAAATACTATGCTATGAAGATTCTGAAG
AAAGAAGTCATTATTGCAAAGGATGAAGTGGCACACACTCTAACTGAAAGCAGAGTATTA
AAGAACACTAGACATCCCTTTTTAACATCCTTGAAATATTCCTTCCAGACAAAAGACCGT
TTGTGTTTTGTGATGGAATATGTTAATGGGGGCGAGCTGTTTTTCCATTTGTCGAGAGAG
CGGGTGTTCTCTGAGGACCGCACACGTTTCTATGGTGCAGAAATTGTCTCTGCCTTGGAC
TATCTACATTCCGGAAAGATTGTGTACCGTGATCTCAAGTTGGAGAATCTAATGCTGGAC
AAAGATGGCCACATAAAAATTACAGATTTTGGACTTTGCAAAGAAGGGATCACAGATGCA
GCCACCATGAAGACATTCTGTGGCACTCCAGAATATCTGGCACCAGAGGTGTTAGAAGAT
AATGACTATGGCCGAGCAGTAGACTGGTGGGGCCTAGGGGTTGTCATGTATGAAATGATG
TGTGGGAGGTTACCTTTCTACAACCAGGACCATGAGAAACTTTTTGAATTAATATTAATG
GAAGACATTAAATTTCCTCGAACACTCTCTTCAGATGCAAAATCATTGCTTTCAGGGCTC
TTGATAAAGGATCCAAATAAACGCCTTGGTGGAGGACCAGATGATGCAAAAGAAATTATG
AGACACAGTTTCTTCTCTGGAGTAAACTGGCAAGATGTATATGATAAAAAGCTTGTACCT
CCTTTTAAACCTCAAGTAACATCTGAGACAGATACTAGATATTTTGATGAAGAATTTACA
GCTCAGACTATTACAATAACACCACCTGAAAAATATGATGAGGATGGTATGGACTGCATG
GACAATGAGAGGCGGCCGCATTTCCCTCAATTTTCCTACTCTGCAAGTGGACGAGAATAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_005465 unedited
CTATAGGGCGGCCGCGAATTCGCACGAGGCCAAACCCTAAAGCTGATATCACAAAGTACC
ATTTCTCCAGTTGGGGGCTCAGAGGGGAGTCATCATGAGCGATGTTACCATTGTGAAAGA
AGGTTGGGTTCAGAAGAGGGGAGAATATATAAAAAACTGGAGGCCAAGATACTTCCTTTT
GAAGACAGATGGCTCATTCATAGGATATAAAGAGAAACCTCAAGATGTGGATTTACCTTA
TCCCCTCAACAACTTTTCAGTGGCAAAATGCCAGTTAATGAAAACAGAACGACCAAAGCC
AAACACATTTATAATCAGATGTCTCCAGTGGACTACTGTTATAGAGAGAACATTTCATGT
AGATACTCCAGAGGAAAGGGAAGAATGGACAGAAGCTATCCAGGCTGTAGCAGACAGACT
GCAGAGGCAAGAAGAGGAGAGAATGAATTGTAGTCCAACTTCACAAATTGATAATATAGG
AGAGGAAGAGATGGATGCCTCTACAACCCATCATAAAAGAAAGACAATGAATGATTTTGA
CTATTTGAAACTACTAGGTAAAGGCACTTTTGGGAAAGTTATTTTGGTTCGAGAGAAGGC
AAGTGGAAAATACTATGCTATGAAGATTCTGAAGAAAGAAGTCATTATTGCAAAGGATGA
AGTGGCACACCCTCTAACTGAAAGCAGAGTATTAAAGAACACTAGACATCCCTTTNTAAC
ATCCTTGAAATATTCCTTCCAGACANAAGACCGTTTGTNGTTTGTGATGGAAATATGTAA
TGGNGGGCGAGCTGNTTTTCCATTTGTCGAGAGAAGCGGTGGTCTCTNGAGACCGCACAC
GTTTCTATGG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_005465
ORF Size 1440 bp
Insert Size 5000
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_005465.3, NP_005456
RefSeq Size 3588
Locus ID 10000
Cytogenetics 1q43-q44
Domains pkinase, pkinase_C, TyrKc, PH, S_TKc
Protein Families Protein Kinase, ES Cell Differentiation/IPS, Druggable Genome
Protein Pathways MAPK signaling pathway, ErbB signaling pathway, Chemokine signaling pathway, mTOR signaling pathway, Apoptosis, VEGF signaling pathway, Focal adhesion, Tight junction, Toll-like receptor signaling pathway, Jak-STAT signaling pathway, T cell receptor signaling pathway, B cell receptor signaling pathway, Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Neurotrophin signaling pathway, Insulin signaling pathway, Progesterone-mediated oocyte maturation, Adipocytokine signaling pathway, Pathways in cancer, Colorectal cancer, Renal cell carcinoma, Pancreatic cancer, Endometrial cancer, Glioma, Prostate cancer, Melanoma, Chronic myeloid leukemia, Acute myeloid leukemia, Small cell lung cancer, Non-small cell lung cancer
Gene Summary The protein encoded by this gene is a member of the AKT, also called PKB, serine/threonine protein kinase family. AKT kinases are known to be regulators of cell signaling in response to insulin and growth factors. They are involved in a wide variety of biological processes including cell proliferation, differentiation, apoptosis, tumorigenesis, as well as glycogen synthesis and glucose uptake. This kinase has been shown to be stimulated by platelet-derived growth factor (PDGF), insulin, and insulin-like growth factor 1 (IGF1). Alternatively splice transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.