TRAF6 (NM_004620) Human Untagged Clone

USD 310.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name TRAF6 (NM_004620) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol TRAF6
Synonyms MGC:3310; RNF85
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>OriGene sequence for NM_004620 edited
GAATTCGGCACGAGGAAGCAGTGGCGTCCGCAGCTGGGGCTTGGCCTGCGGGCGGCCAGC
GAAGGTGGCGAAGGCTCCCACTGGATCCAGAGTTTGCCGTCCAAGCAGCCTCGTCTCGGC
GCGCAGTGTCTGTGTCCGTCCTCTACCAGCGCCTTGGCTGAGCGGAGTCGTGCGGTTGGT
GGGGGAGCCCTGCCCTCCTGGTTCGGCCTCCCCGCGCACTAGAACGAGCAAGTGATAATC
AAGTTACTATGAGTCTGCTAAACTGTGAAAACAGCTGTGGATCCAGCCAGTCTGAAAGTG
ACTGCTGTGTGGCCATGGCCAGCTCCTGTAGCGCTGTAACAAAAGATGATAGTGTGGGTG
GAACTGCCAGCACGGGGAACCTCTCCAGCTCATTTATGGAGGAGATCCAGGGATATGATG
TAGAGTTTGACCCACCCCTGGAAAGCAAGTATGAATGCCCCATCTGCTTGATGGCATTAC
GAGAAGCAGTGCAAACGCCATGCGGCCATAGGTTCTGCAAAGCCTGCATCATAAAATCAA
TAAGGGATGCAGGTCACAAATGTCCAGTTGACAATGAAATACTGCTGGAAAATCAACTAT
TTCCAGACAATTTTGCAAAACGTGAGATTCTTTCTCTGATGGTGAAATGTCCAAATGAAG
GTTGTTTGCACAAGATGGAACTGAGACATCTTGAGGATCATCAAGCACATTGTGAGTTTG
CTCTTATGGATTGTCCCCAATGCCAGCGTCCCTTCCAAAAATTCCATATTAATATTCACA
TTCTGAAGGATTGTCCAAGGAGACAGGTTTCTTGTGACAACTGTGCTGCATCAATGGCAT
TTGAAGATAAAGAGATCCATGACCAGAACTGTCCTTTGGCAAATGTCATCTGTGAATACT
GCAATACTATACTCATCAGAGAACAGATGCCTAATCATTATGATCTAGACTGCCCTACAG
CCCCAATTCCATGCACATTCAGTACTTTTGGTTGCCATGAAAAGATGCAGAGGAATCACT
TGGCACGCCACCTACAAGAGAACACCCAGTCACACATGAGAATGTTGGCCCAGGCTGTTC
ATAGTTTGAGCGTTATACCCGACTCTGGGTATATCTCAGAGGTCCGGAATTTCCAGGAAA
CTATTCACCAGTTAGAGGGTCGCCTTGTAAGACAAGACCATCAAATCCGGGAGCTGACTG
CTAAAATGGAAACTCAGAGTATGTATGTAAGTGAGCTCAAACGAACCATTCGAACCCTTG
AGGACAAAGTTGCTGAAATCGAAGCACAGCAGTGCAATGGAATTTATATTTGGAAGATTG
GCAACTTTGGAATGCATTTGAAATGTCAAGAAGAGGAGAAACCTGTTGTGATTCATAGCC
CTGGATTCTACACTGGCAAACCCGGGTACAAACTGTGCATGCGCTTGCACCTTCAGTTAC
CGACTGCTCAGCGCTGTGCAAACTATATATCCCTTTTTGTCCACACAATGCAAGGAGAAT
ATGACAGCCACCTCCCTTGGCCCTTCCAGGGTACAATACGCCTTACAATTCTTGATCAGT
CTGAAGCACCTGTAAGGCAAAACCACGAAGAGATAATGGATGCCAAACCAGAGCTGCTTG
CTTTCCAGCGACCCACAATCCCACGGAACCCAAAAGGTTTTGGCTATGTAACTTTTATGC
ATCTGGAAGCCCTAAGACAAAGAACTTTCATTAAGGATGACACATTATTAGTGCGCTGTG
AGGTCTCCACCCGCTTTGACATGGGTAGCCTTCGGAGGGAGGGTTTTCAGCCACGAAGTA
CTGATGCAGGGGTATAGCTTGCCCTCACTTGCTCAAAAACAACTACCTGGAGAAAACAGT
GCCTTTCCTTGCCCTGTTCTCAATAACATGCAAACAAACAAGCCACGGGAAATATGTAAT
ATCTACTAGTGAGTGTTGTTAGAGAGGTCACTTACTATTTCTTCCTGTTACAAATGATCT
GAGGCAGTTTTTTCCTGGGAATCCACACGTTCCATGCTTTTTCAGAAATGTTAGGCCTGA
AGTGCCTGTGGCATGTTGCAGCAGCTATTTTGCCAGTTAGTATACCTCTTTGTTGTACTT
TCTTGGGCTTTTGCTCTGGTGTATTTTATTGTCAGAAAGTCCAGACTCAAGAGTACTAAA
CTTTTAATAATAATGGATTTTCCTTAAAACTTCAGTCTTTTTGTAGTATTATATGTAATA
TATTAAAAGTGAAAATCACTACCGCCTTGTGCTAGTGCCCTCGAGAAGAGTTATTGCTCT
AGAAAGTTGAGTTCTCATTTTTTTAACCTGTTATAGATTTCAGAGGATTTGAACCATAAT
CCTTGGAAAACTTAAGTTCTCATTCACCCCAGTTTTTCCTCCAGGTTGTTACTAAGGATA
TTCAGGGATGAGTTTAAACCCTAAATATAACCTTAATTATTTAGTGTAAACATGTCTGTT
GAATAATACTTGTTTAAGTGTTCCTTCTGCCTTGCTTACTTATTTCCTTGAGGTTACGAA
GTAGCNTCTTCCCCAGAGTTTATAATGCTGAGAACCACGTGGATACCAACTGCTCATTGT
TATGCTATGTAACCCTTTTTGTCTATTCAGTGCAGAGTGAATTTCACAGCTCTGCATATG
TCTTCATTTGTTTAATGCTTACAAGACAGGAGATGCACACATACAATCAGCAACATAAAA
ATTANAAGTGACCCAAGTAGTCAGCGCATGTGGCATCTCATTGGTGGTGACAGAAGCTAT
GTGAGCCAGANGTTTTCAGCTCTXXXXXXXXXXXXXXXXXXXXXXXXXCAGCTCAAAAAA
GGAAATGATATTTAAAAGCTTCCTGGTCAGATTTCTATTAAAAGCACTGGCTGTGCATTA
GATACAAAGAGGAGTCATTTCCTGCCTTGGTGATACTATTTTTTTCTACTAACTCAAGAG
TCTTTATTAAAAAAAAAGTTGTTTTGCCTAATTTCAGCTTTTAGCAAGCTTCCCATCTGT
AAAATGATTTGGACCAGATATTTCTAGAGTCCCCTCCAGCCATAACATTCTGTCTCAAAT
TAAGTTCCAACCAGCAGAACACTGACAATACTTAGGAAAGTATTTTGCCAGTATAAAATG
TCTTTAACTTACTCTTTGCTGACACTGATACTTTCCTCTAATTTAGTGTCTATCAGCTGG
GTCACATCTTAAGTAAAATGAGCAATTTTAACCCCCAACATTTGGCATTTTGTCATAAAC
CAGCCAGTTATTTTATGCTGGTCATTCATCTTGACTACAAAGTAGAATAGTCAAGCTGTC
ATTCCAAATAGAAAACTTTTTACTTCAATCAGAATTAAGCCTTAACCTGGAAAGTTGGTT
TCTTCCTTACATTTTCCCAATCTCCTACTCTATTCTTAAACATGCTAGTTTCACTCAGTT
GGGTATACAAGCCTTTGGGCTTTATGTTGTATGTTACTAACCACCTTTTACCATATTTAT
CTTTTGGCATCATTCTGGGACATTGCTAAATTAAAAAAGAAATTGTTTCCACTTTTTTCT
GGAGATGTTCAACTAAAGGTTGTTTTGTTTTGTTTTTTGTTTTGAGACAGTCTCACCACT
GCACTCCAGTCTGGGCAACAGAGCGAGACTCCTTCTCAAAAAAAAAAAAAAAAAAAAAAC
TCGAC
>OriGene 5' read for NM_004620 unedited
GACTCACTATAGGGCGGCCGCGAATTCGCACGAGGAAGCAGTGGCGTCCGCAGCTGGGGC
TTGGCCTGCGGGCGGCCAGCGAAGGTGGCGAAGGCTCCCACTGGATCCAGAGTTTGCCGT
CCAAGCAGCCTCGTCTCGGCGCGCAGTGTCTGTGTCCGTCCTCTACCAGCGCCTTGGCTG
AGCGGAGTCGTGCGGTTGGTGGGGGAGCCCTGCCCTCCTGGTTCGGCCTCCCCGCGCACT
AGAACGAGCAAGTGATAATCAAGTTACTATGAGTCTGCTAAACTGTGAAAACAGCTGTGG
ATCCAGCCAGTCTGAAAGTGACTGCTGTGTGGCCATGGCCAGCTCCTGTAGCGCTGTAAC
AAAAGATGATAGTGTGGGTGGAACTGCCAGCACGGGGAACCTCTCCAGCTCATTTATGGA
GGAGATCCAGGGATATGATGTAGAGTTTGACCCACCCCTGGAAAGCAAGTATGAATGCCC
CATCTGCTTGATGGCATTACGAGAAGCAGTGCAAACGCCATGCGGCCATAGGTTCTGCAA
AGCCTGCATCATAAAATCAATAAGGGNATGCAGGTCACAAATGTCCAGTTGACAATGAAA
TACTGCTGGAAAATCAACTATTTCCAGACAATTTTGCAAAACGTGAGATTCTTTCTCTNG
ATGGTGAAATGTCCAATGAAAGGTTGTTTGCACAAGATGGAACTGAGACATCTTNGAGGA
TCATCAAGCACATTTGTGAGTTTGCTCTTATGGGATTGTNCCCATGCCAGCGTCCCTTCC
AAAAATTCATATTATATTACATTCTGGAAAGATGTCCAGGGAACAGGGTTTCTTGTGACA
CTGTGCTGCATCATGGCATTTGAGATAG
>OriGene 3' read for NM_004620 unedited
GGTCTTCCTTGGCCGCGGCCGCAATCTANGATCGAGTTTTTTTTTTTTTTTTTTTTTTGA
GAAGAGTCTCGCTCTGTTGCCCAGACTGGAGTGCAGTGGTGAGACTGTCTCAAAACAAAA
AACAAAACAAAACAACCTTTAGTTGAACATCTCCAGAAAAAAGTGGAAACAATTTCTTTT
TTAATTTAGCAATGTCCCAGAATGATGCCAAAAGATAAATATGGTAAAAGGTGGTTAGTA
ACATACAACATAAAGCCCAAAGGCTTGTATACCCAACTGAGTGAAACTAGCATGTTTAAG
AATAGAGTAGGAGATTGGGAAAATGTAAGGAAGAAACCAACTTTCCAGGTTAAGGCTTAA
TTCTGATTGAAGTAAAAAGTTTTCTATTTGGAATGACAGCTTGACTATTCTACTTTGTAG
TCAAGATGAATGACCAGCATAAAATAACTGGCTGGTTTATGACAAAATGCCAAATGTTGG
GGGTTAAAATTGCTCATTTTACTTAAGATGTGACCCAGCTGATAGACACTAAATTAGAGG
AAAGTATCAGTGTCAGCAAAGAGTAAGTTAAAGACATTTTATACTGGCAAAATACTTTCC
TAAGTATTGTCAGTGTTCTGCTGGTTGGAACTTAATTTGAGACAGAATGTTATGGCTGGA
GGGGACTCTAGAAATATCTGGTCCAAATCATTTTACAGATGGGAAGCTTGCTAAAAGCTG
AAATTANGCAAAACAACTTTNTTTTTAATAAAGACTCTTGAGTTAGTAGAAAAAAATAGT
ATCACCAAAGCAGGAAATGACTCCTCTTTGTATCTAATGCACAGCCAGTGCTTTTAATAG
AAATCTGACCAGGAAGCCTTTAAATATACTTTCCCTTTTTTGAGCTGGGGGCGTGGAGAT
AAATTGTTTTGTGGCAACACTTAATT
Restriction Sites NotI-NotI     
ACCN NM_004620
Insert Size 4470 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004620.2, NP_004611.1
RefSeq Size 2515 bp
RefSeq ORF 1569 bp
Locus ID 7189
Cytogenetics 11p12
Domains zf-TRAF, RING, MATH
Protein Families Druggable Genome
Protein Pathways Endocytosis, MAPK signaling pathway, Neurotrophin signaling pathway, NOD-like receptor signaling pathway, Pathways in cancer, RIG-I-like receptor signaling pathway, Small cell lung cancer, Toll-like receptor signaling pathway, Ubiquitin mediated proteolysis
Gene Summary The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins are associated with, and mediate signal transduction from, members of the TNF receptor superfamily. This protein mediates signaling from members of the TNF receptor superfamily as well as the Toll/IL-1 family. Signals from receptors such as CD40, TNFSF11/RANCE and IL-1 have been shown to be mediated by this protein. This protein also interacts with various protein kinases including IRAK1/IRAK, SRC and PKCzeta, which provides a link between distinct signaling pathways. This protein functions as a signal transducer in the NF-kappaB pathway that activates IkappaB kinase (IKK) in response to proinflammatory cytokines. The interaction of this protein with UBE2N/UBC13, and UBE2V1/UEV1A, which are ubiquitin conjugating enzymes catalyzing the formation of polyubiquitin chains, has been found to be required for IKK activation by this protein. This protein also interacts with the transforming growth factor (TGF) beta receptor complex and is required for Smad-independent activation of the JNK and p38 kinases. This protein has an amino terminal RING domain which is followed by four zinc-finger motifs, a central coiled-coil region and a highly conserved carboxyl terminal domain, known as the TRAF-C domain. Two alternatively spliced transcript variants, encoding an identical protein, have been reported. [provided by RefSeq, Feb 2012]
Transcript Variant: This variant (2) lacks a segment in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.

Citations (3)

Other Versions

Other products for "TRAF6"
Frequently bought together (2)
Anti-TRAF6 Rabbit Polyclonal Antibody
    • 100 ul

USD 345.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools