ABCD4 (NM_020324) Human Untagged Clone

CAT#: SC109688

ABCD4 (untagged)-Human ATP-binding cassette, sub-family D (ALD), member 4 (ABCD4), transcript variant 3

USD 618


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name ABCD4 (NM_020324) Human Untagged Clone
Symbol ABCD4
Synonyms P70R, P79R, ABC41, PMP69, PXMP1L, EST352188
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC109688 sequence for NM_020324 edited (data generated by NextGen Sequencing)
ATGGCCAGCAAGCTCATCATCTCCCCGTTCACCCTCGTCTACTACACTTACCAGTGCTTC
CAAAGCACAGGCTGGCTCGGGCCTGTGAGCATCTTCGGGTATTTCATCCTGGGGACCGTG
GTGAACAAAACTTTGATGGGCCCCATTGTGATGAAGCTGGTGCATCAGGAGAAGCTGGAG
GGAGATTTTAGGTTCAAGCACATGCAGATTCGGGTGAATGCGGAGCCTGCTGCTTTCTAC
AGAGCTGGGCATGTGGAGCACATGAGGACAGACCGCAGGCTGCAGAGACTCCTTCAGACC
CAGAGGGAGCTGATGTCCAAGGAGCTCTGGCTGTACATCGGCATCAACACCTTTGACTAT
CTGGGCAGCATCCTGAGTTATGTTGTCATCGCAATCCCCATTTTCAGCGGGGTCTATGGA
GACCTGAGTCCCGCAGAGCTTAGCACCCTGGTCAGCAAGAATGCCTTTGTGTGCATCTAC
CTCATCAGCTGCTTCACCCAGCTAATCGACCTGTCCACGACGCTCTCAGATGTGGCTGGC
TACACGCACAGAATTGGGCAGCTTCGGGAGACGCTTCTGGACATGTCCCTGAAGTCACAG
GACTGCGAGATCCTGGGCGAGAGCGAGTGGGGCTTGGACACACCCCCAGGGTGGCCAGCG
GCAGAGCCAGCAGACACAGCATTTCTCCTTGAGCGGGTCTCCATCTCTGCCCCCTCCTCT
GACAAACCCCTAATCAAGGATCTGAGCCTAAAGATCTCCGAGGGACAGAGCCTGCTCATC
ACAGGCAACACGGGCACTGGCAAGACCTCCTTGCTCCGGGTTCTAGGTGGCCTCTGGACG
AGTACACGGGGCTCAGTGCAGATGCTGACGGACTTTGGGCCCCATGGGGTGCTATTCCTG
CCACAAAAGCCATTCTTCACTGACGGGACCCTTCGGGAGCAGGTGATATATCCCCTGAAG
GAGGTCTACCCCGACTCAGGTTCTGCCGATGATGAGAGGATCTTGAGGTTCTTGGAATTG
GCAGGCCTGTCCAACTTGGTGGCAAGGACAGAGGGCCTGGACCAGCAGGTGGACTGGAAC
TGGTATGATGTTCTGTCCCCGGGGGAGATGCAACGGCTCTCCTTTGCCCGACTCTTCTAC
CTGCAGCCGAAGTACGCAGTGCTTGATGAAGCCACCAGTGCCCTGACAGAGGAAGTGGAG
AGCGAGCTCTATCGCATCGGCCAGCAGCTGGGGATGACGTTCATCAGTGTGGGACATCGG
CAGAGCCTTGAGAAGTTTCATTCCTTGGTTCTGAAACTCTGTGGAGGAGGAAGATGGGAG
CTGATGAGAATCAAAGTGGAATGA

Clone variation with respect to NM_020324.1
504 c=>a;1056 t=>c
5' Read Nucleotide Sequence
>OriGene 5' read for NM_020324 unedited
NGGTTCACATTTGTATACGACTCATATAGGCGGCCGCGNAATTCGCACGAGGGCGGGGCC
CGCGCCCGGAGCTGGCGCCAGGCCCAGGTTAGATCTGCAATTTCTCCAGCGGTTCCTGCA
GATACTGAAGGTTTTGTTTCCTTCTTGGTCATCACAAAATGCCTTGATGTTCCTGACCCT
TTTGTGCCTGACCCTACTGGAGCAATTTGTGATCTACCAGGTTGGCCTGATCCCCAGTCA
GTACTATGGGGTCCTGGGAAACAAAGACTTGGAAGGGTTTAAGACTCTGACATTCCTGGC
TGTCATGCTCATTGTTCTGAACTCCACGCTGAAGAGCTTTGATCAGTTCACCTGCAACCT
GCTGTATGTGAGCTGGAGGAAGGACCTCACTGAGCACCTTCACCGCCTCTACTTCCGGGG
CCGTGCGTACTACACCCTCAACGTGCTGCGGGATGACATCGATAACCCGGACCAGCGCAT
CAGCCAGGACGTGGAGCGATTCTGCCGGCAGCTCAGCAGCATGGCCAGCAAGCTCATCAT
CTCCCCGTTCACCCTCGTCTACTACACTTACCAGTGCTTCCAAAGCACAGGCTGGCTCGG
GCCTGTGAGCATCTTCGGGTATTTCATCCTGGGGACCGTGGTGAACAAAACTTTGATGGG
CCCCATTGTGATGAAGCTGGTGCATCAGGAGAAGCTGGAGGGAGATTTTAGGTTCAAGCA
CATGCAGATTCGGGTGAATGCGGAGCCTGCTGCTTTCTACAGAGCTGGGCATGTGGAGCA
CATGANGACAGACCGCNAGCTGCAGAGACTCCTTCAGACCCAGAGGGAGCTGATGTCCAA
GGAGCTCTGGCTGTACATCGGCATCAACACCTTTGACTATCTGGGCAGCANCCTGAGTTA
CGTTGTCATCGCAATCCCT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_020324 unedited
CTATGGACCCGCGGCCGCAATCTAGGATCGAGTTNTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTCTTTTTTTTTAAAAAAAAACAAAAAGCTGGAATTCTTTTTAATGGTTAAC
TTTTCTTTGGAAAAAACTTATTAAAAAACTTAAATGGGCAGTTAAAGTTAAAAATCTATT
GCTGCACAATTTAACTGATTAAAAGATTTCCAGATCTCTTGACTCCAAAAGTCATTTTTT
TCATTTCTTACAAATCTCACACTTCCAAATTTCTCTTTACCAAACATGATCTGAAATCAT
TTGTAGGTAATCAGCACTTCAAGCATATGGAGGCTTTGGCTGAGGCACCAAAGTCCTGGG
AAACTGAACACTGGGAAATTCAGTGTCCCCCACAAAAACCTAAACCTGGGCTCAACCCAC
CACTGCTAGGGGTCCTGCACAGGACCCATGTGGCTCCTGCCCGGGATCTATGGGGCGAAC
CTGAGCTCGATCTTCGCTGTCAGTCCTCCTGGTCTCTCCTGAGGGCCGCCGACCCGCCAC
AGTGTGGCTCTCCTTCCAAAAGCCAGAGCTTCATTCCACTTTGATTCTTATCAGCTCCCA
TCTTCCTCCTCCCAGAGTTTCAGAACCAAGGAATGAAACTTCTCAAGGTTCTGCCGATTC
CCCCACTGATAACGTCATCCCCACCTGCTGGCCGATGCGATAGAGCTCGTCCTCACTTCC
TCTGCAAGGCACTGGTGCCTCATCAACCCCTGGCACTTCGGCTGAGGAAAAAGAGCGGGC
AAAGAAACCGCTGCATTTCCCCCGGGACAGACATTTTACAACTTCATCCACCGGCTGGCC
AGCCCTTGTCCTTGCCCCAAGTGGCAGGCTCGCAATCCAAAACTAAAACCTCTTATATTG
CAAACCTGATCGGGACCCCCCTTAGGGAATATACCCCCCCCAGGCCCCCACGG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_020324
ORF Size 2787 bp
Insert Size 2240
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_020324.1, NP_064720
RefSeq Size 2787
RefSeq ORF 2787
Locus ID 5826
Cytogenetics 14q24.3
Domains ABC_tran, AAA
Protein Families Transmembrane, Druggable Genome
Protein Pathways ABC transporters
Gene Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. The function of this peroxisomal membrane protein is unknown. However, it is speculated that it may function as a heterodimer for another peroxisomal ABC transporter and, therefore, may modify the adrenoleukodystrophy phenotype. It may also play a role in the process of peroxisome biogenesis. Alternative splicing results in at least two different transcript variants, one which is protein-coding and one which is probably not protein-coding. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (3) lacks exon 4, as compared to the full-length transcript variant 1. This deletion results in a 159-amino acid frameshift deletion in the 5' portion of the coding region.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.