IL1RAP (NM_002182) Human Untagged Clone

CAT#: SC109339

IL1RAP (untagged)-Human interleukin 1 receptor accessory protein (IL1RAP), transcript variant 1

USD 917


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name IL1RAP (NM_002182) Human Untagged Clone
Symbol IL1RAP
Synonyms C3orf13; IL-1RAcP; IL1R3
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002182 edited
GAATTCGGCACCAGCAGGTCTCCGGGGTCCGCTTTGGCCAGAGGCGCGGAAGGAAGCAGT
GCCCGGCGACACTGCACCCATCCCGGCTGCTTTTGCTGCGCCCTCTCAGCTTCCCAAGAA
AGGCATCGTCATGTGATCATCACCTAAGAACTAGAACATCAGCAGGCCCTAGAAGCCTCA
CTCTTGCCCCTCCCTTTAATATCTCAAAGGATGACACTTCTGTGGTGTGTAGTGAGTCTC
TACTTTTATGGAATCCTGCAAAGTGATGCCTCAGAACGCTGCGATGACTGGGGACTAGAC
ACCATGAGGCAAATCCAAGTGTTTGAAGATGAGCCAGCTCGCATCAAGTGCCCACTCTTT
GAACACTTCTTGAAATTCAACTACAGCACAGCCCATTCAGCTGGCCTTACTCTGATCTGG
TATTGGACTAGGCAGGACCGGGACCTTGAGGAGCCAATTAACTTCCGCCTCCCCGAGAAC
CGCATTAGTAAGGAGAAAGATGTGCTGTGGTTCCGGCCCACTCTCCTCAATGACACTGGC
AACTATACCTGCATGTTAAGGAACACTACATATTGCAGCAAAGTTGCATTTCCCTTGGAA
GTTGTTCAAAAAGACAGCTGTTTCAATTCCCCCATGAAACTCCCAGTGCATAAACTGTAT
ATAGAATATGGCATTCAGAGGATCACTTGTCCAAATGTAGATGGATATTTTCCTTCCAGT
GTCAAACCGACTATCACTTGGTATATGGGCTGTTATAAAATACAGAATTTTAATAATGTA
ATACCCGAAGGTATGAACTTGAGTTTCCTCATTGCCTTAATTTCAAATAATGGAAATTAC
ACATGTGTTGTTACATATCCAGAAAATGGACGTACGTTTCATCTCACCAGGACTCTGACT
GTAAAGGTAGTAGGCTCTCCAAAAAATGCAGTGCCCCCTGTGATCCATTCACCTAATGAT
CATGTGGTCTATGAGAAAGAACCAGGAGAGGAGCTACTCATTCCCTGTACGGTCTATTTT
AGTTTTCTGATGGATTCTCGCAATGAGGTTTGGTGGACCATTGATGGAAAAAAACCTGAT
GACATCACTATTGATGTCACCATTAACGAAAGTATAAGTCATAGTAGAACAGAAGATGAA
ACAAGAACTCAGATTTTGAGCATCAAGAAAGTTACCTCTGAGGATCTCAAGCGCAGCTAT
GTCTGTCATGCTAGAAGTGCCAAAGGCGAAGTTGCCAAAGCAGCCAAGGTGAAGCAGAAA
GTGCCAGCTCCAAGATACACAGTGGAACTGGCTTGTGGTTTTGGAGCCACAGTCCTGCTA
GTGGTGATTCTCATTGTTGTTTACCATGTTTACTGGCTAGAGATGGTCCTATTTTACCGG
GCTCATTTTGGAACAGATGAAACCATTTTAGATGGAAAAGAGTATGATATTTATGTATCC
TATGCAAGGAATGCGGAAGAAGAAGAATTTGTATTACTGACCCTCCGTGGAGTTTTGGAG
AATGAATTTGGATACAAGCTGTGCATCTTTGACCGAGACAGTCTGCCTGGGGGAATTGTC
ACAGATGAGACTTTGAGCTTCATTCAGAAAAGCAGACGCCTCCTGGTTGTTCTAAGCCCC
AACTACGTGCTCCAGGGAACCCAAGCCCTCCTGGAGCTCAAGGCTGGCCTAGAAAATATG
GCCTCTCGGGGCAACATCAACGTCATTTTAGTACAGTACAAAGCTGTGAAGGAAACGAAG
GTGAAAGAGCTGAAGAGGGCTAAGACGGTGCTCACGGTCATTAAATGGAAAGGGGAAAAA
TCCAAGTATCCACAGGGCAGGTTCTGGAAGCAGCTGCAGGTGGCCATGCCAGTGAAGAAA
AGTCCCAGGCGGTCTAGCAGTGATGAGCAGGGCCTCTCGTATTCATCTTTGAAAAATGTA
TGAAAGGAATAATGAAAAGGGTAAAAAGAACAAGGGGTGCTCCAGGAAGAAAGAGTCCCC
CCAGTCTTCATTCGCAGTTTATGGTTTCATAGGCAAAAATAATGGTCTAAGCCTCCCAAT
AGGGATAAATTTAGGGTGACTGTGTGGCTGACTATTCTGCTTCCTCAGGCAACACTAAAG
TTTAGAAAGATATCATCAACGTTCTGTCACCAGTCTCTGATGCCACTATGTTCTTTGCAG
GCAAAGACTTGTTCAATGCGAATTTCCCCTTCTACATTGTCTATCCCTGTTTTTATATGT
CTCCATTCTTTTTAAAATCTTAACATATGGAGCAGCCTTTCCTATGAATTTAAATATGCC
TTTAAAATAAGTCACTGTTGACAGGGTCATGAGTTTCCGAGTATAGTTTTCTTTTTATCT
TATTTTTACTCGTCCGTTGAAAAGATAATCAAGGCCTACATTTTAGCTGAGGATAATGAA
CTTTTTTCCTCATTCGGCTGTATAATACATAACCACAGCAAGACTGACATCCACTTAGGA
TGATACAAAGCAGTGTAACTGAAAATGTTTCTTTTAATTGATTTAAAGGACTTGTCTTCT
ATACCACCCTTGTCCTCATCTCAGGTAATTTATGAAATCTATGTAAACTTGAAAAATATT
TCTTAATTTTTGTTTTTGCTCCAGTCAATTCCTGATTATCCACAGGTCAACCCACATTTT
TTCATTCCTTCTCCCTATCTGCTTATATCGCATTGCTCATTTAGAGTTTGCAGGAGGCTC
CATACTAGGTTCAGTCTGAAAGAAATCTCCTAATGGTGCTATAGAGAXXXXXXXXXXXXX
XXXXXXXXXXXCTCGAC
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002182 unedited
GTGCGAATTTTGTAATACGAACTCACTATAGGGCGGCCGCGAATTCGCACCAGCAGGTCT
CCGGGGTCCGCTTTGGCCAGAGGCGCGGAAGGAAGCAGTGCCCGGCGACACTGCACCCAT
CCCGGCTGCTTTTGCTGCGCCCTCTCAGCTTCCCAAGAAAGGCATCGTCATGTGATCATC
ACCTAAGAACTAGAACATCAGCAGGCCCTAGAAGCCTCACTCTTGCCCCTCCCTTTAATA
TCTCAAAGGATGACACTTCTGTGGTGTGTAGTGAGTCTCTACTTTTATGGAATCCTGCAA
AGTGATGCCTCAGAACGCTGCGATGACTGGGGACTAGACACCATGAGGCAAATCCAAGTG
TTTGAAGATGAGCCAGCTCGCATCAAGTGCCCACTCTTTGAACACTTCTTGAAATTCAAC
TACAGCACAGCCCATTCAGCTGGCCTTACTCTGATCTGGTATTGGACTAGGCAGGACCGG
GACCTTGAGGAGCCAATTAACTTCCGCCTCCCCGAGAACCGCATTAGTAAGGAGAAAGAT
GTGCTGTGGTTCCGGCCCACTCTCCTCAATGACACTGGCAACTATACCTGCATGTTAAGG
AACACTACATATTGCAGCAAAGTTGCATTTCCCTTGGAAGTTGTTCAAAAAGACAGCTGT
TTCAATTCCCCCATGAAACTCCCAGTGCATAAACTGTATATAGAATATGGCATTCAGAGG
ATCACTTGTCCAAATGTAGATGGATATTTTCCTTCCAGTGTCAAACCGACTATCACTTGG
TATATGNGGCTGTTATAAAATACAGAATTTTAATAATGGTATACCCCGAAGGTATGAACT
TGAGGTTCCTCATTGCCTTAATTTCAAATAATGGAAAATACACATGTTGTTGGTACATAT
CCCAGAAATGGACGTACGTTTCATCTCCACAGGACTCTG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_002182
ORF Size 1713 bp
Insert Size 4700
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002182.2, NP_002173
RefSeq Size 4726
RefSeq ORF 1713
Locus ID 3556
Cytogenetics 3q28
Domains TIR, ig, IG
Protein Families Secreted Protein, Transmembrane, Druggable Genome
Protein Pathways Cytokine-cytokine receptor interaction, Apoptosis
Gene Summary Interleukin 1 induces synthesis of acute phase and proinflammatory proteins during infection, tissue damage, or stress, by forming a complex at the cell membrane with an interleukin 1 receptor and an accessory protein. This gene encodes the interleukin 1 receptor accessory protein. The protein is a necessary part of the interleukin 1 receptor complex which initiates signalling events that result in the activation of interleukin 1-responsive genes. Alternative splicing of this gene results in two transcript variants encoding two different isoforms, one membrane-bound and one soluble. The ratio of soluble to membrane-bound forms increases during acute-phase induction or stress. [provided by RefSeq, Nov 2009].
Transcript Variant: This variant (1) encodes the membrane-bound isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations