hnRNP A1 (HNRNPA1) (NM_031157) Human Untagged Clone
SKU
SC109309
HNRNPA1 (untagged)-Human heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1), transcript variant 2
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | hnRNP A1 |
Synonyms | ALS19; ALS20; hnRNP-A1; hnRNP A1; HNRPA1; HNRPA1L3; IBMPFD3; UP 1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_031157 edited
TTCACCCTGCCGTCATGTCTAAGTCAGAGTCTCCTAAAGAGCCCGAACAGCTGAGGAAGC TCTTCATTGGAGGGTTGAGCTTTGAAACAACTGATGAGAGCCTGAGGAGCCATTTTGAGC AATGGGGAACGCTCACGGACTGTGTGGTAATGAGAGATCCAAACACCAAGCGCTCCAGGG GCTTTGGGTTTGTCACATATGCCACTGTGGAGGAGGTGGATGCAGCTATGAATGCAAGGC CACACAAGGTGGATGGAAGAGTTGTGGAACCAAAGAGAGCTGTCTCCAGAGAAGATTCTC AAAGACCAGGTGCCCACTTAACTGTGAAAAAGATATTTGTTGGTGGCATTAAAGAAGACA CTGAAGAACATCACCTAAGAGATTATTTTGAACAGTATGGAAAAATTGAAGTGATTGAAA TCATGACTGACCGAGGCAGTGGCAAGAAAAGGGGCTTTGCCTTTGTAACCTTTGACGACC ATGACTCCGTGGATAAGATTGTCATTCAGAAATACCATACTGTGAATGGCCACAACTGTG AAGTTAGAAAAGCCCTGTCAAAGCAAGAGATGGCTAGTGCTTCATCCAGCCAAAGAGGTC GAAGTGGTTCTGGAAACTTTGGTGGTGGTCGTGGAGGTGGTTTCGGTGGGAATGACAACT TCGGTCGTGGAGGAAACTTCAGTGGTCGTGGTGGCTTTGGTGGCAGCCGTGGTGGTGGTG GATATGGTGGCAGTGGGGATGGCTATAATGGATTTGGTAATGATGGTGGTTATGGAGGAG GCGGCCCTGGTTACTCTGGAGGAAGCAGAGGCTATGGAAGTGGTGGACAGGGTTATGGAA ACCAGGGCAGTGGCTATGGCGGGAGTGGCAGCTATGACAGCTATAACAACGGAGGCGGAG GCGGCTTTGGCGGTGGTAGTGGAAGCAATTTTGGAGGTGGTGGAAGCTACAATGATTTTG GGAATTACAACAATCAGTCTTCAAATTTTGGACCCATGAAGGGAGGAAATTTTGGAGGCA GAAGCTCTGGCCCCTATGGCGGTGGAGGCCAATACTTTGCAAAACCACGAAACCAAGGTG GCTATGGCGGTTTCAGCAGCAGCAGTAGCTATGGCAGTGGCAGAAGATTTTAATTAGGAA ACAAAGCTT |
Restriction Sites | Please inquire |
ACCN | NM_031157 |
Insert Size | 1200 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_031157.1. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_031157.1, NP_112420.1 |
RefSeq Size | 1925 bp |
RefSeq ORF | 1119 bp |
Locus ID | 3178 |
UniProt ID | P09651 |
Cytogenetics | 12q13.13 |
Domains | RRM |
Protein Pathways | Spliceosome |
Summary | This gene encodes a member of a family of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs), which are RNA-binding proteins that associate with pre-mRNAs in the nucleus and influence pre-mRNA processing, as well as other aspects of mRNA metabolism and transport. The protein encoded by this gene is one of the most abundant core proteins of hnRNP complexes and plays a key role in the regulation of alternative splicing. Mutations in this gene have been observed in individuals with amyotrophic lateral sclerosis 20. Multiple alternatively spliced transcript variants have been found. There are numerous pseudogenes of this gene distributed throughout the genome. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (2, also known as A1B) contains an alternate in-frame exon compared to variant 1, resulting in a longer protein (isoform b) than isoform 1. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC211626 | HNRNPA1 (Myc-DDK-tagged)-Human heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1), transcript variant 2 | 10 ug |
$457.00
|
|
RC211626L1 | Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1), transcript variant 2, Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC211626L2 | Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1), transcript variant 2, mGFP tagged | 10 ug |
$757.00
|
|
RC211626L3 | Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1), transcript variant 2, Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC211626L4 | Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1), transcript variant 2, mGFP tagged | 10 ug |
$757.00
|
|
RG211626 | HNRNPA1 (tGFP-tagged) - Human heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1), transcript variant 2 | 10 ug |
$489.00
MSRP
$657.00
MSRP
$657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.