Cathepsin B(CTSB) (NM_001908) Human Untagged Clone

CAT#: SC109129

CTSB (untagged)-Human cathepsin B (CTSB), transcript variant 1

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Cathepsin B(CTSB) (NM_001908) Human Untagged Clone
Symbol CTSB
Synonyms APPS; CPSB
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC109129 sequence for NM_001908 edited (data generated by NextGen Sequencing)
ATGTGGCAGCTCTGGGCCTCCCTCTGCTGCCTGCTGGTGTTGGCCAATGCCCGGAGCAGG
CCCTCTTTCCATCCCCTGTCGGATGAGCTGGTCAACTATGTCAACAAACGGAATACCACG
TGGCAGGCCGGGCACAACTTCTACAACGTGGACATGAGCTACTTGAAGAGGCTATGTGGT
ACCTTCCTGGGTGGGCCCAAGCCACCCCAGAGAGTTATGTTTACCGAGGACCTGAAGCTG
CCTGCAAGCTTCGATGCACGGGAACAATGGCCACAGTGTCCCACCATCAAAGAGATCAGA
GACCAGGGCTCCTGTGGCTCCTGCTGGGCCTTCGGGGCTGTGGAAGCCATCTCTGACCGG
ATCTGCATCCACACCAATGCGCACGTCAGCGTGGAGGTGTCGGCGGAGGACCTGCTCACA
TGCTGTGGCAGCATGTGTGGGGACGGCTGTAATGGTGGCTATCCTGCTGAAGCTTGGAAC
TTCTGGACAAGAAAAGGCCTGGTTTCTGGTGGCCTCTATGAATCCCATGTAGGGTGCAGA
CCGTACTCCATCCCTCCCTGTGAGCACCACGTCAACGGCTCCCGGCCCCCATGCACGGGG
GAGGGAGATACCCCCAAGTGTAGCAAGATCTGTGAGCCTGGCTACAGCCCGACCTACAAA
CAGGACAAGCACTACGGATACAATTCCTACAGCGTCTCCAATAGCGAGAAGGACATCATG
GCCGAGATCTACAAAAACGGCCCCGTGGAGGGAGCTTTCTCTGTGTATTCGGACTTCCTG
CTCTACAAGTCAGGAGTGTACCAACACGTCACCGGAGAGATGATGGGTGGCCATGCCATC
CGCATCCTGGGCTGGGGAGTGGAGAATGGCACACCCTACTGGCTGGTTGCCAACTCCTGG
AACACTGACTGGGGTGACAATGGCTTCTTTAAAATACTCAGAGGACAGGATCACTGTGGA
ATCGAATCAGAAGTGGTGGCTGGAATTCCACGCACCGATCAGTACTGGGAAAAGATCTAA

Clone variation with respect to NM_001908.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001908 unedited
GTCAAAATTTGTAATACGAACTCACTATAGGGCGGCCGCGAATCGGCACGAGGCTCCGCT
GCGCGCAGGCTGGGCTGCAGGCTCTCGGCTGCAGCGCTGGGTGGATCTAGGATCCGGCTT
CCAACATGTGGCAGCTCTGGGCCTCCCTCTGCTGCCTGCTGGTGTTGGCCAATGCCCGGA
GCAGGCCCTCTTTCCATCCCCTGTCGGATGAGCTGGTCAACTATGTCAACAAACGGAATA
CCACGTGGCAGGCCGGGCACAACTTCTACAACGTGGACATGAGCTACTTGAAGAGGCTAT
GTGGTACCTTCCTGGGTGGGCCCAAGCCACCCCAGAGAGTTATGTTTACCGAGGACCTGA
AGCTGCCTGCAAGCTTCGATGCACGGGAACAATGGCCACAGTGTCCCACCATCAAAGAGA
TCAGAGACCAGGGCTCCTGTGGCTCCTGCTGGGCCTTCGGGGCTGTGGAAGCCATCTCTG
ACCGGATCTGCATCCACACCAATGCGCACGTCAGCGTGGAGGTGTCGGCGGAGGACCTGC
TCACATGCTGTGGCAGCATGTGTGGNGACGGCTGTAATGGTGGCTATCCTGCTGAAGCTT
GGAACTTCTGGACAAGAAAAGGCCTGGTTTCTGGTGGCCTCTATGAATCCCATGTANGGT
GCAGACCGTACTCCATCCCTCCCTGTGAGCACCACGTCAACGGCTCCCGGGCCCCATGCA
CGGNGGNAGGNAGATACCNNCCAGTGTAGCAAGATCTGTGAGCCTGGCTACAGNCCGACC
TACAACAGGACAAGCACTACNGATACAANTNCTACAGCGTCTCCATAGCGAGAAGACATC
ATGGNCGAGACTACANAACGGNCCNGTGNAGGGAGCTTCTCTTGTATTCGGACTTCTGCT
CTACAGTCAGATGTACCCACACGTACCGAGAATGAAGGGTGGNCATG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_147782 unedited
GGGTTTTACTTGNACCGCGGCCCGCTTCTANGATCGAGTTTTTTTTTTTTTTTTTTTTTT
TTTTTAGACTTCAAGTTGGGAAAAACCTTTTATTGGCACAGGCATTCCTTGTTAACTTGA
CAGGGTGAAGCTGTAATTTTTCAAAAACAGTAAAAGCTGGTTTCTCCTAAACTATTTTCC
TTGGGGTAGTAGAGATCAGTGGGTCAGAAACAACTCCTGACCACTTGGTTTCCTTTTGAG
CCGCGTCATTAGGAGGCAATCTGTAAAACTAGCACAGGTCTCCCGCTGTTCCACTGGCTC
ACCCACATGATTAGCAGAGTGCACGAAAAAATAAAACTTCTATTAAAGAATCATGCTGAG
CACAACATCAGAGAGGTTGTGACATTGCAAACTCGATAGATGCAGGGGGCCTGGGAGACT
GGCGTTCTCCAAAGGGCTCCCAACACCATCTCTCCTCTGATTTCTGTGACAAATGTGGAA
AGCTACTTGCTTGGAGGTACTGGGGGAACTGATGGGGGAACTTTCATCCTGTTAGGAACT
CCGCTTTCCATTCCTGCGTCTCTGTCTTGCTCCCTGGAGATGGATGGATCACGGAGGGGG
CCACAGTCAGCTGGGGCAGCAGGTACTCCCTACGGCACTAGTCTACAGGGGGAAGGACGC
TCTGTGCTGGCAGCGGTGGCTCACATGGCCTGTCTGCACTGTAACCACAGGCTGGGGATG
GATCCAGGACTTTGGTCTCCTTGGAACACCGGTCTGATGTTTGTCCAAATCAGTCCTTAA
GACCCTGCCTGAAACTGGTTCCTTACGGAACCTTAAGAATAAAAGCTTTTTACCCGGTTC
TCCCCCCAGACTGGCCGAAAGGCCCAGGGAAATTAAACTTTTCCCGTACTGAACGGGCCG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001908
ORF Size 1020 bp
Insert Size 2000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001908.3, NP_001899
RefSeq Size 3783
RefSeq ORF 1020
Locus ID 1508
Cytogenetics 8p23.1
Domains Pept_C1
Protein Families Protease, Druggable Genome
Protein Pathways Lysosome, Antigen processing and presentation
Gene Summary Thiol protease which is believed to participate in intracellular degradation and turnover of proteins. Has also been implicated in tumor invasion and metastasis. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the shortest but predominant transcript. All five variants encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations