SCD1(SCD) (NM_005063) Human Untagged Clone

CAT#: SC108809

SCD (untagged)-Human stearoyl-CoA desaturase (delta-9-desaturase) (SCD)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name SCD1(SCD) (NM_005063) Human Untagged Clone
Symbol SCD
Synonyms FADS5; hSCD1; MSTP008; SCD1; SCDOS
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC108809 sequence for NM_005063 edited (data generated by NextGen Sequencing)
ATGCCGGCCCACTTGCTGCAGGACGATATCTCTAGCTCCTATACCACCACCACCACCATT
ACAGCGCCTCCCTCCAGGGTCCTGCAGAATGGAGGAGATAAGTTGGAGACGATGCCCCTC
TACTTGGAAGACGACATTCGCCCTGATATAAAAGATGATATATATGACCCCACCTACAAG
GATAAGGAAGGCCCAAGCCCCAAGGTTGAATATGTCTGGAGAAACATCATCCTTATGTCT
CTGCTACACTTGGGAGCCCTGTATGGGATCACTTTGATTCCTACCTGCAAGTTCTACACC
TGGCTTTGGGGGGTATTCTACTATTTTGTCAGTGCCCTGGGCATAACAGCAGGAGCTCAT
CGTCTGTGGAGCCACCGCTCTTACAAAGCTCGGCTGCCCCTACGGCTCTTTCTGATCATT
GCCAACACAATGGCATTCCAGAATGATGTCTATGAATGGGCTCGTGACCACCGTGCCCAC
CACAAGTTTTCAGAAACACATGCTGATCCTCATAATTCCCGACGTGGCTTTTTCTTCTCT
CACGTGGGTTGGCTGCTTGTGCGCAAACACCCAGCTGTCAAAGAGAAGGGGAGTACGCTA
GACTTGTCTGACCTAGAAGCTGAGAAACTGGTGATGTTCCAGAGGAGGTACTACAAACCT
GGCTTGCTGCTGATGTGCTTCATCCTGCCCACGCTTGTGCCCTGGTATTTCTGGGGTGAA
ACTTTTCAAAACAGTGTGTTCGTTGCCACTTTCTTGCGATATGCTGTGGTGCTTAATGCC
ACCTGGCTGGTGAACAGTGCTGCCCACCTCTTCGGATATCGTCCTTATGACAAGAACATT
AGCCCCCGGGAGAATATCCTGGTTTCACTTGGAGCTGTGGGTGAGGGCTTCCACAACTAC
CACCACTCCTTTCCCTATGACTACTCTGCCAGTGAGTACCGCTGGCACATCAACTTCACC
ACATTCTTCATTGATTGCATGGCCGCCCTCGGTCTGGCCTATGACCGGAAGAAAGTCTCC
AAGGCCGCCATCTTGGCCAGGATTAAAAGAACCGGAGATGGAAACTACAAGAGTGGCTGA

Clone variation with respect to NM_005063.4
670 a=>c
5' Read Nucleotide Sequence
>OriGene 5' read for NM_005063 unedited
GTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGAGCATCCCCGGCGCCCT
GCTGCGGTCGCCGCGAGCCTCGGCCTCTGTCTCCTCCCCCTCCCGCCCTTACCTCCACGC
GGGACCGCCCGCGCCAGTCAACTCCTCGCACTTTGCCCCTGCTTGGCAGCGGATAAAAGG
GGGCTGAGGAAATACCGGACACGGTCACCCGTTGCCAGCTCTAGCCTTTAAATTCCCGGC
TCGGGGACCTCCACGCACCGCGGCTAGCGCCGACAACCAGCTAGCGTGCAAGGCGCCGCG
GCTCAGCGCGTACCGGCGGGCTTCGAAACCGCAGTCCTCCGGCGACCCCGAACTCCGCTC
CGGAGCCTCAGCCCCCTGGAAAGTGATCCCGGCATCGGAGAGCCAAGATGCCGGCCCACT
TGCTGCAGGACGATATCTCTAGCTCCTATACCACCACCACCACCATTACAGCGCCTCCCT
CCAGGGTCCTGCAGAATGGAGGAGATAAGTTGGAGACGATGCCCCTCTACTTGGAAGACG
ACATTCGCCCTGATATAAAAGATGATATATATGANCCCCACCTACAAGGATAAGGGAAGG
CCCAAGCCCCAAGGTTGAATATGTCTGGAGAAACATCATCCTTATGTCTCTGCTACACTT
GGGAGCCCTGTATGGGATCACTTTGATTCCTACCTGNCAGTTCTACACCTGGCNTTGGGG
GGTATTCTACTATTTTGTCAGTGCCCTGGGCATACAGCANGAGCTCATCGTCTGTGGAGC
CACCGCTCTTACAAGCTCGGCTGCCCCTACGGCTCTTTCTGATCATTGNCACACATGGNC
ATTCAGAATGATGTCTATGAATGGGCTCGTGACACCGTGCCCACCACAGTTTTCAGAACA
N
3' Read Nucleotide Sequence
>OriGene 3' read for NM_005063 unedited
AACCACAAAAAAAACAANNACAAATAANNNNNATAACCTTGACTTTGGNACCGCGGCCGC
ATNCTAGNGATCGGTTTTTTTTTTTTTTTTTTCAGATCACTTCACTTTTATTATGAACAA
ACACAATCTCAGATTAGTACAATTAGCTTCAGAGTTGATATTAATAGAAATTATTCCAAA
ATTATTCTTGTCACAAGTAACTACTATATCCCACATAAAAAGGGAAAAAATCCCACCCAA
TCACAGAAAAGGCATCCTCTGTATGTTTCCGTGGCAATGCGTTGTTTATGTATTCTCAAA
TTTTGTCTGGCTAGTTATCCACCGCTTCTCCAATGGATTCATTCAGTTTCTTGGAGAACC
ATATAGACTAATGACAGCATCTGGGACACACGGACGTATCAAGTTCATGGTGGACATTCC
TATTATAAAAAATACTCAGGTCTTGAGAATTCCTGTGCTGAAGGATCCCAAAATGCTTTC
TAAAAAGCATTAGTCATGCCTCAAAACTGCCCTTTGAGGTAGGTCAGTATTATTATCCCC
ATTTTAACAGAAGGAAAACTGAGGCACCTTATAGTTAAGTGACTTGCCCAGGGTCACACA
GCAAGTCAGTGGCACAGTGGTTGGAGAGGCCCTGGCCTTAACCACCAGCATAACATGGCC
ACCTCGCTTTTTTAACCTTTCATGATGACCTATTTGAGCTACACTTACAGAGGATACCCC
CCCAGATACTAGGCAAACCAAGGAGAAAATTTTCCATTTTAAAATGCTACAACCATCTTT
TTACCCCAAAAAAAAAAAAAAAACTTATTAAATCAAATACTTTCAAATTTATTTCCACCC
CCCCATCAAAAGTGGGGCCCTTAAAAAAAGCAGCCCTAACAAAGGTTCCAGAAATGAACC
CCAGAGGGGAACCCTGCAACCGGGAAACCTGATATCCCCCCCTCAAGCCN
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_005063
ORF Size 1080 bp
Insert Size 5150
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_005063.4, NP_005054
RefSeq Size 5473
RefSeq ORF 1080
Locus ID 6319
Cytogenetics 10q24.31
Domains FA_desaturase
Protein Families Transmembrane
Protein Pathways Biosynthesis of unsaturated fatty acids, PPAR signaling pathway
Gene Summary This gene encodes an enzyme involved in fatty acid biosynthesis, primarily the synthesis of oleic acid. The protein belongs to the fatty acid desaturase family and is an integral membrane protein located in the endoplasmic reticulum. Transcripts of approximately 3.9 and 5.2 kb, differing only by alternative polyadenlyation signals, have been detected. A gene encoding a similar enzyme is located on chromosome 4 and a pseudogene of this gene is located on chromosome 17. [provided by RefSeq, Sep 2015].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations