TXNIP (NM_006472) Human Untagged Clone

CAT#: SC108573

TXNIP (untagged)-Human thioredoxin interacting protein (TXNIP)

USD 721


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name TXNIP (NM_006472) Human Untagged Clone
Symbol TXNIP
Synonyms ARRDC6; EST01027; HHCPA78; THIF; VDUP1
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_006472 edited
GTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGAATT
TTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCCTCGTGCCGAATTC
GGCACGAGGCTTTTTCTCCAAAGGAGTGCTTGTGGAGATCGGATCTTTTCTCCAGCAATT
GGGGGAAAGAAGGCTTTTTCTCTGAATTCGCTTAGTGTAACCAGCGGCGTATATTTTTTA
GGCGCCTTTTCGAAAACCTAGTAGTTAATATTCATTTGTTTAAATCTTATTTTATTTTTA
AGCTCAAACTGCTTAAGAATACCTTAATTCCTTAAAGTGAAATAATTTTTTGCAAAGGGG
TTTCCTCGATTTGGAGCTTTTTTTTTCTTCCACCGTCATTTCTAACTCTTAAAACCAACT
CAGTTCCATCATGGTGATGTTCAAGAAGATCAAGTCTTTTGAGGTGGTCTTTAACGACCC
TGAAAAGGTGTACGGCAGTGGCGAGAAGGTGGCTGGCCGGGTGATAGTGGAGGTGTGTGA
AGTTACTCGTGTCAAAGCCGTTAGGATCCTGGCTTGCGGAGTGGCTAAAGTGCTTTGGAT
GCAGGGATCCCAGCAGTGCAAACAGACTTCGGAGTACCTGCGCTATGAAGACACGCTTCT
TCTGGAAGACCAGCCAACAGGTGAGAATGAGATGGTGATCATGAGACCTGGAAACAAATA
TGAGTACAAGTTCGGCTTTGAGCTTCCTCAGGGGCCTCTGGGAACATCCTTCAAAGGAAA
ATATGGGTGTGTAGACTACTGGGTGAAGGCTTTTCTTGACCGCCCGAGCCAGCCAACTCA
AGAGACAAAGAAAAACTTTGAAGTAGTGGATCTGGTGGATGTCAATACCCCTGATTTAAT
GGCACCTGTGTCTGCTAAAAAAGAAAAGAAAGTTTCCTGCATGTTCATTCCTGATGGGCG
GGTGTCTGTCTCTGCTCGAATTGACAGAAAAGGATTCTGTGAAGGTGATGAGATTTCCAT
CCATGCTGACTTTGAGAATACATGTTCCCGAATTGTGGTCCCCAAAGCTGCCATTGTGGC
CCGCCACACTTACCTTGCCAATGGCCAGACCAAGGTGCTGACTCAGAAGTTGTCATCAGT
CAGAGGCAATCATATTATCTCAGGGACATGCGCATCATGGCGTGGCAAGAGCCTTCGGGT
TCAGAAGATCAGGCCTTCTATCCTGGGCTGCAACATCCTTCGAGTTGAATATTCCTTACT
GATCTATGTTAGCGTTCCTGGATCCAAGAAGGTCATCCTTGACCTGCCCCTGGTAATTGG
CAGCAGATCAGGTCTAAGCAGCAGAACATCCAGCATGGCCAGCCGAACCAGCTCTGAGAT
GAGTTGGGTAGATCTGAACATCCCTGATACCCCAGAAGCTCCTCCCTGCTATATGGATGT
CATTCCTGAAGATCACCGATTGGAGAGCCCAACCACTCCTCTGCTAGATGACATGGATGG
CTCTCAAGACAGCCCTATCTTTATGTATGCCCCTGAGTTCAAGTTCATGCCACCACCGAC
TTATACTGAGGTGGATCCCTGCATCCTCAACAACAATGTGCAGTGAGCATGTGGAAGAAA
AGAAGCAGCTTTACCTACTTGTTTCTTTTTGTCTCTCTTCCTGGACACTCACTTTTTCAG
AGACTCAACAGTCTCTGCAATGGAGTGTGGGTCCACCTTAGCCTCTGACTTCCTAATGTA
GGAGGTGGTCAGCAGGCAATCTCCTGGGCCTTAAAGGATGCGGACTCATCCTCAGCCAGC
GCCCATGTTGTGATACAGGGGTGTTTGTTGGATGGGTTTAAAAATAACTAGAAAAACTCA
GGCCCATCCATTTTCTCAGATCTCCTTGAAAATTGAGGCCTTTTCGATAGTTTCGGGTCA
GGTAAAAATGGCCTCCTGGCGTAAGCTTTTCAAGGTTTTTTGGAGGCTTTTTGTAAATTG
TGATAGGAACTTTGGACCTTGAACTTACGTATCATGTGGAGAAGAGCCAATTTAACAAAC
TAGGAAGATGAAAAGGGAAATTGTGGCCAAAACTTTGGGAAAAGGAGGTTCTTAAAATCA
GTGTTTCCCCTTTGTGCACTTGTAGAAAAAAAAGAAAAACCTTCTAGAGCTGATTTGATG
GACAATGGAGAGAGCTTTCCCTGTGATTATAAAAAAGGAAGCTAGCTGCTCTACGGTCAT
CTTTGCTTAGAGTATACTTTAACCTGGCTTTTAAAGCAGTAGTAACTGCCCCACCAAAGG
TCTTAAAAGCCATTTTTGGAGCCTATTGCACTGTGTTCTCCTACTGCAAATATTTTCATA
TGGGAGGATGGTTTTCTCTTCATGT
5' Read Nucleotide Sequence
>OriGene 5' read for NM_006472 unedited
TACGATATTTGTATACGACTTCACTATAGGGCGGCCGCGAATTCGCACGAGGCCTCGTGC
CGAATTCGGCACGAGGCTTTTTCTCCAAGGAGTGCTTGTGGAGATCGGATCTTTTCTCCA
GCAATTGGGGGAAAGAAGGCTTTTTCTCTGAATTCGCTTAGTGTAACCAGCGGCGTATAT
TTTTTAGGCGCCTTTTCGAAAACCTAGTAGTTAATATTCATTTGTTTAAATCTTATTTTA
TTTTTAAGCTCAAACTGCTTAAGAATACCTTAATTCCTTAAAGTGAAATAATTTTTTGCA
AAGGGGTTTCCTCGATTTGGAGCTTTTTTTTTCTTCCACCGTCATTTCTAACTCTTAAAA
CCAACTCAGTTCCATCATGGTGATGTTCAAGAAGATCAAGTCTTTTGAGGTGGTCTTTAA
CGACCCTGAAAAGGTGTACGGCAGTGGCGAGAAGGTGGCTGGCCGGGTGATAGTGGAGGT
GTGTGAAGTTACTCGTGTCAAAGCCGTTAGGATCCTGGCTTGCGGAGTGGCTAAAGTGCT
TTGGATGCAGGGATCCCAGCAGTGCAAACAGACTTCGGAGTACCTGCGCTATGAAGACAC
GCTTCTTCTGGAAGACCAGCCAACAGGTGAGAATGAGATGGTGATCATGAGACCTGGAAA
CAATATGAGTACAAGTTCGGCTTTGAGCTTCCTCAGGGGCCTCTGGGAACATCCTTCAAA
GAAAATATGGGTGTGTAGACTACTGGGTGAAGGCTTTTCTTGACCGCCCGAGCCAGCCAA
CTCAAGAGACAAAGAAAACTTTGAAATACTGGATCTGGTGGGAGGCAATACCCCTGATTA
ATGCCACCTGGGTCTGCTAAAAAGAAAAGAAGTTCCTGCATGTTCCTCCTGAAGGGCGGG
TGGCTGTCTCTGCTTCAATTGCACCAAAGGAATCTGT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_006472 unedited
NGGTTTTTGCTGTGNNAAGACGGCCCGCTTTTCTAAGATCGAGTTTTTTTTTTTTTTTTT
TCCATTAAAAAAACTTTATTTTCATTTTTTACAAAAAAACCCCCATCTGGGGTAAAAAAT
ATCTGGTTAAGTACAAAATATAGTCTTTACCATACAAAAAGATACATAATACAAAAACAT
GAAACCAACCATCTTCAGCCCACACTTTCTGGCTGTAATAACTCTCAGAAAAGGGTGGAG
CTCAGTGCTCTGACACAGGACAGTGAACAAAGTGCTATGGCTGAGAGTGACTGACCAAGT
GCTGGCAGCTGCAGTGAGGGGCCAATATCCCTATCTCCTAACACAGGGCAGGAAGGGGGT
TCAAAGGGCTTTTATGAAGACCTGCCCTCTAGTTTCTCATGGCAGTATTTGGAGGTTCTG
ATCACAGGGTTGGGCATTTTGATCAAGAGTCCCTCCTTGGGTTCGAAGCCACAGCGGGCA
AGGCTGACAGCAGCAACCCTCTCACATGCTTCAAGTGCTACAACCATATACCTCCGCCCA
TCGGGGTAATCTCAAAAGCAGTACAAATCTCTCCCGTCTCTCTGCATTCACCCCTATTCC
ACATCAGCCACCCTATTCTCCCGTCTTACATTGTATGATGGTCCCACGGCGGCCCAACAT
AACCCCGTGACCAGGCACTTCACAGTGGCTTAACACACATAACCCTTTATACCCTCCCCC
CTCAGGACCTCCACCGCACATAGACCACCCTTCCTACCTTAACCGATACAACACTCGCAG
CCAGGCAATTCCCAGCGTGAAAAGGGCTCCCACCACCGGCCCTCTACAGCACCTCCCGTG
GGGCGGTGATTACTACCTGCCCTTTCTCACCCATCTCCTAACTTTTCCCTTTATCCCCCT
TTACCCGTAATGGAAAAAATTACCTTCCTCTCCACCCAGCCCAAACCCCTCTCTCTT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_006472
ORF Size 1176 bp
Insert Size 2260
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_006472.1, NP_006463
RefSeq Size 2704
RefSeq ORF 1176
Locus ID 10628
Cytogenetics 1q21.1
Domains arrestin
Protein Families Druggable Genome
Gene Summary This gene encodes a thioredoxin-binding protein that is a member of the alpha arrestin protein family. Thioredoxin is a thiol-oxidoreductase that is a major regulator of cellular redox signaling which protects cells from oxidative stress. This protein inhibits the antioxidative function of thioredoxin resulting in the accumulation of reactive oxygen species and cellular stress. This protein also functions as a regulator of cellular metabolism and of endoplasmic reticulum (ER) stress. This protein may also function as a tumor suppressor. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015].
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations