RIP(RIPK1) (NM_003804) Human Untagged Clone

CAT#: SC108466

RIPK1 (untagged)-Human receptor (TNFRSF)-interacting serine-threonine kinase 1 (RIPK1)

USD 1,288.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name RIP(RIPK1) (NM_003804) Human Untagged Clone
Symbol RIPK1
Synonyms RIP; RIP-1; RIP1
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_003804 edited
ATGCAACCAGACATGTCCTTGAATGTCATTAAGATGAAATCCAGTGACTTCCTGGAGAGT
GCAGAACTGGACAGCGGAGGCTTCGGGAAGGTGTCTCTGTGTTTCCACAGAACCCAGGGA
CTCATGATCATGAAAACAGTGTACAAGGGGCCCAACTGCATTGAGCACAACGAGGCCCTC
TTGGAGGAGGCGAAGATGATGAACAGACTGAGACACAGCCGGGTGGTGAAGCTCCTGGGC
GTCATCATAGAGGAAGGGAAGTACTCCCTGGTGATGGAGTACATGGAGAAGGGCAACCTG
ATGCACGTGCTGAAAGCCGAGATGAGTACTCCGCTTTCTGTAAAAGGAAGGATAATTTTG
GAAATCATTGAAGGAATGTGCTACTTACATGGAAAAGGCGTGATACACAAGGACCTGAAG
CCTGAAAATATCCTTGTTGATAATGACTTCCACATTAAGATCGCAGACCTCGGCCTTGCC
TCCTTTAAGATGTGGAGCAAACTGAATAATGAAGAGCACAATGAGCTGAGGGAAGTGGAC
GGCACCGCTAAGAAGAATGGCGGCACCCTCTACTACATGGCGCCCGAGCACCTGAATGAC
GTCAACGCAAAGCCCACAGAGAAGTCGGATGTGTACAGCTTTGCTGTAGTACTCTGGGCG
ATATTTGCAAATAAGGAGCCATATGAAAATGCTATCTGTGAGCAGCAGTTGATAATGTGC
ATAAAATCTGGGAACAGGCCAGATGTGGATGACATCACTGAGTACTGCCCAAGAGAAATT
ATCAGTCTCATGAAGCTCTGCTGGGAAGCGAATCCGGAAGCTCGGCCGACATTTCCTGGC
ATTGAAGAAAAATTTAGGCCTTTTTATTTAAGTCAATTAGAAGAAAGTGTAGAAGAGGAC
GTGAAGAGTTTAAAGAAAGAGTATTCAAACGAAAATGCAGTTGTGAAGAGAATGCAGTCT
CTTCAACTTGATTGTGTGGCAGTACCTTCAAGCCGGTCAAATTCAGCCACAGAACAGCCT
GGTTCACTGCACAGTTCCCAGGGACTTGGGATGGGTCCTGTGGAGGAGTCCTGGTTTGCT
CCTTCCCTGGAGCACCCACAAGAAGAGAATGAGCCCAGCCTGCAGAGTAAACTCCAAGAC
GAAGCCAACTACCATCTTTATGGCAGCCGCATGGACAGGCAGACGAAACAGCAGCCCAGA
CAGAATGTGGCTTACAACAGAGAGGAGGAAAGGAGACGCAGGGTCTCCCATGACCCTTTT
GCACAGCAAAGACCTTACGAGAATTTTCAGAATACAGAGGGAAAAGGCACTGCTTATTCC
AGTGCAGCCAGTCATGGTAATGCAGTGCACCAGCCCTCAGGGCTCACCAGCCAACCTCAA
GTACTGTATCAGAACAATGGATTATATAGCTCACATGGCTTTGGAACAAGACCACTGGAT
CCAGGAACAGCAGGTCCCAGAGTTTGGTACAGGCCAATTCCAAGTCATATGCCTAGTCTG
CATAATATCCCAGTGCCTGAGACCAACTATCTAGGAAATACACCCACCATGCCATTCAGC
TCCTTGCCACCAACAGATGAATCTATAAAATATACCATATACAATAGTACTGGCATTCAG
ATTGGAGCCTACAATTATATGGAGATTGGTGGGACGAGTTCATCACTACTAGACAGCACA
AATACGAACTTCAAAGAAGAGCCAGCTGCTAAGTACCAAGCTATCTTTGATAATACCACT
AGTCTGACGGATAAACACCTGGACCCAATCAGGGAAAATCTGGGAAAGCACTGGAAAAAC
TGTGCCCGTAAACTGGGCTTCACACAGTCTCAGATTGATGAAATTGACCATGACTATGAG
CGAGATGGACTGAAAGAAAAGGTTTACCAGATGCTCCAAAAGTGGGTGATGAGGGAAGGC
ATAAAGGGAGCCACGGTGGGGAAGCTGGCCCAGGCGCTCCACCAGTGTTCCAGGATCGAC
CTTCTGAGCAGCTTGATTTACGTCAGCCAGAACTAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_003804 unedited
CAGTATTTTGTAATACGACTCACTTATAGGGCGGCCGCGAATTCGCACGAGGGCGTTCTT
GAGCTTCAGAATGCAACCAGACTGTCCTTGAATGTCATTAAGATGAAATCCAGTGACTTC
CTGGAGAGTGCAGAACTGGACAGCGGAGGCTTCGGGAAGGTGTCTCTGTGTTTCCACAGA
ACCCAGGGACTCATGATCATGAAAACAGTGTACAAGGGGCCCAACTGCATTGAGCACAAC
GAGGCCCTCTTGGAGGAGGCGAAGATGATGAACAGACTGAGACACAGCCGGGTGGTGAAG
CTCCTGGGCGTCATCATAGAGGAAGGGAAGTACTCCCTGGTGATGGAGTACATGGAGAAG
GGCAACCTGATGCACGTGCTGAAAGCCGAGATGAGTACTCCGCTTTCTGTAAAAGGAAGG
ATAATTTTGGAAATCATTGAAGGAATGTGCTACTTACATGGAAAAGGCGTGATACACAAG
GACCTGAAGCCTGAAAATATCCTTGTTGATAATGACTTCCACATTAAGATCGCAGACCTC
GGCCTTGCCTCCTTTAAGATGTGGAGCAAACTGAATAATGAAGAGCACAATGAGCTGAGG
GAAGTGGACGGCACCGCTAAGAAGAATGGCGGCACCCTCTACTACATGGCGCCCGAGCAC
CTGAATGACGTCAACGCAAAGCCCACAGAGAAGTCGGATGTGTACAGCTTTGCTGTAGTA
CTCTGGGCGATATTTGCAAATAAGGAGCCCATATGAAATGCTATCTGTGAGCAGCAGTTG
ATAATGTGCATAAAATCTGGGAACAGGCCAGATGTGGATGACATCACTGAGTACTGCCCA
AGAGA
3' Read Nucleotide Sequence
>OriGene 3' read for NM_003804 unedited
TCTAGAGTCGAGTTTTTTTTTTTTTTTTTTTTTTTGGGGGATAAATTTTTATTTTAAAAA
GTGTTAAAAAATGCCTTGCCCTCTTGCCTTTGAACATTAATTATTCAACCTCTTTGGAAT
CTAAGAGATTTGATAACACCATTTGGATGGTGGTACAAGGAGCAAACAGAACTCACCCAG
GCCCCTCCAGCAAAGCCTGGAGCCTCCCTCCATTCTCCCTTTTGGGCTGTAGGAGCCAAG
GCTGCGTGGTGGCCAAGTAGTAACCGGACAGGTGCAGACAGGAGAGCCGAGGCTCATTAC
TTTACAGCAGTGCTCTTCTCAACCGGGGCAATTTTCCCCTTTCCTTGGACCATTTGACAA
TGTTTAGAGACTATTGTCACAACTGGGGCGGGGGGCTGGGGAGAACAGTGCCCCTGGCAT
CTAGTAGGTGGGGGCAGGGATGCTACTAAACATCCTACAAGGAACAGGACAGTCCCCACA
ACAGAATTACCCCAGCCCGAGATGCCGACAGTGGCAAGGCTGAGACAGCCTGCTCTGCAC
CCCATTTCAGGGGTGTGTATGTGTCTGCTAGAGTTGAGGGGATTTACAATCAGAATCAAC
CACACTGTTATCAGCCCAAGAACCAGAATCTGTCCGACAGCCAGATTGCCATTACACACC
CTTTTTGGCCTCCCTCTGGGGAGAGCTAGCACAAAGCCTTCCTTTGTCCGTTTACAAAAT
GCCAGTGACACTGAGCGGGCTACCCAGCTTAAGCTTTTATATTAGTCTTTAATCCCCCCC
AAGTTTAAGTGGCCTTTGAAGGCTGGTGCTAAAGCCCAATACCCACTTAGAGCTGCCTTT
TTACTTTGTCCCCAGAAAAATTGAAAATCTTTCAGTCCCCGATTAACCGAGGAACCCTTA
ACAGTTAACCCTTGGGTTCTGGCTACCCAAGTAAAAAAAAATTTCTGTTCTTCCAAGCCC
TACGCTGGGAGGCCAAATGCCGAAAACTTTAAGTATCAGATTTTGTGACCACGTAAC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_003804
ORF Size 2016 bp
Insert Size 3900
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_003804.3, NP_003795
RefSeq Size 3864
Locus ID 8737
Cytogenetics 6p25.2
Domains death, pkinase, TyrKc, S_TKc
Protein Families Protein Kinase, Druggable Genome
Protein Pathways Apoptosis, Toll-like receptor signaling pathway, RIG-I-like receptor signaling pathway, Cytosolic DNA-sensing pathway
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations