Cullin 1(CUL1) (NM_003592) Human Untagged Clone

CAT#: SC108409

CUL1 (untagged)-Human cullin 1 (CUL1)

USD 721


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Cullin 1(CUL1) (NM_003592) Human Untagged Clone
Symbol CUL1
Synonyms MGC149834; MGC149835
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_003592, the custom clone sequence may differ by one or more nucleotides


ATGTCGTCAACCCGGAGCCAGAACCCCCACGGCCTGAAGCAGATTGGCCTGGACCAGATCTGGGACGACC
TCAGAGCCGGCATCCAGCAGGTGTACACACGGCAGAGCATGGCCAAGTCCAGATATATGGAGCTCTACAC
TCATGTTTATAACTACTGTACTAGTGTTCACCAGTCAAACCAAGCACGAGGAGCTGGAGTTCCTCCTTCT
AAGTCGAAAAAGGGGCAGACACCTGGAGGAGCTCAGTTTGTTGGCCTGGAATTATATAAACGACTTAAGG
AATTTTTGAAGAATTACTTGACAAATCTTCTTAAGGATGGAGAAGATTTGATGGATGAGAGTGTACTGAA
ATTCTACACTCAACAATGGGAAGATTATCGATTTTCAAGCAAAGTGCTGAATGGAATTTGTGCCTACCTC
AATAGACATTGGGTTCGCCGTGAATGTGACGAAGGACGAAAAGGAATATATGAAATCTATTCGCTTGCAT
TGGTGACTTGGAGAGACTGTCTGTTCAGGCCACTGAATAAACAGGTAACAAATGCTGTTTTAAAGCTGAT
TGAAAAGGAAAGGAATGGTGAAACCATCAATACAAGATTGATTAGTGGAGTTGTACAGTCTTACGTGGAA
TTGGGGCTGAATGAAGATGATGCATTTGCAAAGGGCCCTACGTTAACAGTGTATAAAGAATCCTTTGAAT
CTCAATTTTTGGCTGACACAGAGAGATTTTATACCAGAGAGAGTACTGAATTCTTGCAGCAGAACCCAGT
TACTGAATATATGAAAAAGGCAGAGGCTCGTCTGCTTGAGGAACAACGAAGAGTTCAGGTTTACCTTCAT
GAAAGCACACAAGATGAATTAGCAAGGAAATGTGAACAAGTCCTCATTGAAAAACACTTGGAAATTTTCC
ACACAGAATTTCAGAATTTATTGGATGCTGACAAAAATGAAGATTTGGGACGCATGTATAATCTTGTATC
TAGAATCCAGGATGGCCTAGGAGAATTGAAAAAACTGTTGGAGACACACATTCATAATCAGGGTCTTGCA
GCCATTGAAAAGTGTGGAGAAGCTGCTTTAAATGACCCCAAAATGTATGTACAGACAGTGCTTGATGTTC
ATAAAAAATACAATGCCCTGGTAATGTCTGCATTCAACAATGACGCTGGCTTTGTGGCTGCTCTTGATAA
GGCTTGTGGTCGCTTCATAAACAACAACGCGGTTACCAAGATGGCCCAATCATCCAGTAAATCCCCTGAG
TTGCTGGCTCGATACTGTGACTCCTTGTTGAAGAAAAGTTCCAAGAACCCAGAGGAGGCAGAACTAGAAG
ACACACTCAATCAAGTGATGGTTGTCTTCAAGTACATAGAAGACAAAGACGTATTTCAGAAGTTCTATGC
GAAGATGCTCGCCAAGAGGCTCGTCCACCAGAACAGTGCAAGTGACGATGCCGAAGCCAGCATGATCTCC
AAGTTAAAGCAAGCTTGCGGGTTCGAGTACACCTCTAAACTTCAGCGCATGTTTCAAGACATTGGCGTGA
GCAAAGATCTGAACGAGCAATTCAAAAAGCACTTGACAAACTCAGAACCCCTAGACTTGGATTTCAGCAT
TCAAGTGCTGAGCTCCGGGTCCTGGCCCTTCCAGCAGTCTTGTACATTTGCCTTGCCGTCAGAGTTGGAA
CGTAGTTATCAGCGATTCACAGCTTTCTACGCCAGCCGCCACAGTGGCCGAAAATTGACGTGGTTATATC
AGTTGTCTAAAGGAGAATTGGTAACTAACTGCTTCAAAAACAGATATACTTTGCAGGCGTCGACATTCCA
GATGGCTATCCTGCTTCAGTACAACACGGAAGATGCCTACACTGTGCAGCAGCTGACCGACAGCACTCAA
ATTAAAATGGACATTTTGGCGCAAGTTTTACAGATTTTATTAAAGTCGAAGCTATTGGTCTTGGAAGATG
AAAATGCAAATGTTGATGAGGTGGAATTGAAGCCAGATACCTTAATAAAATTATATCTTGGTTATAAAAA
TAAGAAATTAAGGGTTAACATCAATGTGCCAATGAAAACCGAACAGAAGCAGGAACAAGAAACCACACAC
AAAAACATCGAGGAAGACCGCAAACTACTGATTCAGGCGGCCATCGTGAGAATCATGAAGATGAGGAAGG
TTCTGAAACACCAGCAGTTACTTGGCGAGGTCCTCACTCAGCTGTCCTCCAGGTTCAAACCTCGAGTCCC
TGTGATCAAGAAATGCATTGACATTCTAATTGAGAAAGAATATTTGGAGCGAGTGGATGGTGAAAAGGAC
ACCTACAGTTACTTGGCTTAA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_003592 unedited
NAATTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCGGAAGTCCGC
GCCGATTAGGAGGGCCACCTCTGACTTTCTGATCTGGGGTGCAACCCCCAGTCCCTGTCG
CGGTCGACAAAGGTTTGCCTGCAATGAGATTTCATTCTCTACATTTAAAGGACATCCTTT
CTGAGCTGCTGTGAATAAATTTGGAATGGTACTGTATATTTTCATCTAATGGAGAACTAG
CTGTACTTTGAATAAGGATTGCTGCACTGGACGACTTTAGAACATCCCTCACAATGTCGT
CAACCCGGAGCCAGAACCCCCACGGCCTGAAGCAGATTGGCCTGGACCAGATCTGGGACG
ACCTCAGAGCCGGCATCCAGCAGGTGTACACACGGCAGAGCATGGCCAAGTCCAGATATA
TGGAGCTCTACACTCATGTTTATAACTACTGTACTAGTGTTCACCAGTCAAACCAAGCAC
GAGGAGCTGGNAGTTCCTCCTTCTAAGTCGAAAAAGGGGCAGACACCTGNAGGAGCTCAG
TTTGTTGGCCTGGAATTATATAAACGACTTAAGGAATTTTTGAAGAATTACTTGNACAAT
CTTCTTAANGATGGAGAAGATTTGATGATGAAAAGTGTACCTGAAATTCTACACTNNCAC
ATGGGAAGATANATCGATNTCAAACAAAGTGCTGAATGGAAATTTGTGCCTACTCATAAC
AAATTGGNTTTCGCCGGTGATGTNNACGAAGGACGAAAGGGATATNTGAAATCTATTCCT
TGCATTGGGACTGNAAAAAAATCTGNTCTTGTTCAAGCACTGAATACAGGCAAAGGCCTG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_003592 unedited
CTTGAACGCGGCCGCAATCTAGGATCGAGTTTTTTTTTTTTTTTTTTGCACAATCATTAT
ATCTTTTATTTACATATAGAAATTAGTAAAACTTAAAACAAAACCCAATGCGACTTGTAC
AGAAATCCTTTAATTTTCTTTATTTTCACACATTAAAAAATGAAACACACTATACAAATG
GTTTTCATAGCAGGTTACATGTGGGTCCACTCAGACTTGCTCTCAAAGTGCTGCCAACGT
GACAAGTGCTGCCAAGACGACAGCTGCGAATCGGGGAGCCCATGTATTGACTTAGTGCGG
TAGCATGCAGCCCTCGGCACGGAGGGTCAGTCCCCGCTGTTCTTAAATTAGGGTAAATGG
CGTTGGTGTCCGTATTTACAGACTTGAAATGTATCAATCCTGAGCAGTTCCGATGTAAAT
CCGAGACCAGCTGATGGGAGTCTTGGTCTCAGTTTTTAAAAGGGAGGTCCAATGGCGGCA
GGCTGGCTGCTATGAACTTGAGTTGTTTTCATTCTTTCCAACATGAACTATTTGCTGCGG
GTCACACAGTCAGACCCTTCCAGAAGGGTTAAGCCAAGTAACTGTAGGTGTCCTTTTCAC
CATCCACTCGCTCCAAATATTCTTTCTCAATTAGAATGTCAATGCATTTCTTGATCACAG
GGACTCGAGGTTTGAACCTGGAGGACAGCTGAGTGAGGACCTCGCCAAGTAACTGCTGGT
GTTTCAGAACCTTCCTCATCTTCATGATTCTCACGATGGCCGCCTGAATCAGTAGTTTGC
GGGCCTCCTCGATGTTNTTGTGTGTGGTTTCTTGGTCCTGCTTCTGNNTCGNTNTCATTG
CACATTGATGNTAACCCTTAATTNCTTATTTTATAACCAAGAATAATNNTATAAGGTATC
TGGCTTCATTCCACTCATCACATTGCATTTCATCTTCAAGACCATAGCTCACTTTATAAA
TCTGTAACTGCGCAAAGTCATTNNATTGGAGG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_003592
ORF Size 2331 bp
Insert Size 2840
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_003592.2, NP_003583
RefSeq Size 3226
RefSeq ORF 2331
Locus ID 8454
Cytogenetics 7q36.1
Domains Cullin
Protein Families Druggable Genome
Protein Pathways Cell cycle, Oocyte meiosis, Ubiquitin mediated proteolysis, Wnt signaling pathway, TGF-beta signaling pathway
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.