FZD3 (NM_017412) Human Untagged Clone

CAT#: SC107940

FZD3 (untagged)-Human frizzled family receptor 3 (FZD3), transcript variant 1

 Cited in 2 publications.

  View "NM_017412" in other vectors (10)

USD 1,320.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name FZD3 (NM_017412) Human Untagged Clone
Symbol FZD3
Synonyms Fz-3
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>OriGene ORF within SC107940 sequence for NM_017412 edited (data generated by NextGen Sequencing)
ATGGCTATGACTTGGATTGTCTTCTCTCTTTGGCCCTTGACTGTGTTCATGGGGCATATA
GGTGGGCACAGTTTGTTTTCTTGTGAACCTATTACCTTGAGGATGTGCCAAGATTTGCCT
TATAATACTACCTTCATGCCTAATCTTCTGAATCATTATGACCAACAGACAGCAGCTTTG
GCAATGGAGCCATTCCACCCTATGGTGAATCTGGATTGTTCTCGGGATTTCCGGCCTTTT
CTTTGTGCACTCTACGCTCCTATTTGTATGGAATATGGACGTGTCACACTTCCCTGTCGT
AGGCTGTGTCAGCGGGCTTACAGTGAGTGTTCGAAGCTCATGGAGATGTTTGGTGTTCCT
TGGCCTGAAGATATGGAATGCAGTAGGTTCCCAGATTGTGATGAGCCATATCCTCGACTT
GTGGATCTGAATTTAGCTGGAGAACCAACTGAAGGAGCCCCAGTGGCAGTGCAGAGAGAC
TATGGTTTTTGGTGTCCCCGAGAGTTAAAAATTGATCCTGATCTGGGTTATTCTTTTCTG
CATGTGCGTGATTGTTCACCTCCTTGTCCAAATATGTACTTCAGAAGAGAAGAACTGTCA
TTTGCTCGCTATTTCATAGGATTGATTTCAATCATTTGCCTCTCGGCCACATTGTTTACT
TTTTTAACTTTTTTGATTGATGTCACAAGATTCCGTTATCCTGAAAGGCCTATTATATTT
TATGCAGTCTGCTACATGATGGTATCCTTAATTTTCTTCATTGGATTTTTGCTTGAAGAT
CGAGTAGCCTGCAATGCATCCATCCCTGCACAATATAAGGCTTCCACAGTGACACAAGGA
TCTCATAATAAAGCCTGTACCATGCTTTTTATGATACTCTATTTTTTTACTATGGCTGGC
AGTGTATGGTGGGTAATTCTTACCATCACATGGTTTTTAGCAGCTGTGCCAAAGTGGGGT
AGTGAAGCTATTGAGAAGAAAGCATTGCTGTTTCACGCCAGTGCATGGGGCATCCCCGGA
ACTCTAACCATCATCCTTTTAGCGATGAATAAAATTGAAGGTGACAATATTAGTGGCGTG
TGTTTTGTTGGCCTCTACGATGTTGATGCATTGAGATATTTTGTTCTTGCTCCCCTCTGC
CTGTATGTGGTAGTTGGGGTTTCTCTCCTCTTAGCTGGCATTATATCCCTAAACAGAGTT
CGAATTGAGATTCCATTAGAAAAGGAGAACCAAGATAAATTAGTGAAGTTTATGATCCGG
ATCGGTGTTTTCAGCATTCTTTATCTCGTACCACTCTTGGTTGTAATTGGATGCTACTTT
TATGAGCAAGCTTACCGGGGCATCTGGGAAACAACGTGGATACAAGAACGCTGCAGAGAA
TATCACATTCCATGTCCATATCAGGTTACTCAAATGAGTCGTCCAGACTTGATTCTCTTT
CTGATGAAATACCTGATGGCTCTCATAGTTGGCATTCCCTCTGTATTTTGGGTTGGAAGC
AAAAAGACATGCTTTGAATGGGCCAGTTTTTTTCATGGTCGTAGGAAAAAAGAGATAGTG
AATGAGAGCCGACAGGTACTCCAGGAACCTGATTTTGCTCAGTCTCTCCTGAGGGATCCA
AATACTCCTATCATAAGAAAGTCAAGGGGAACTTCCACTCAAGGAACATCCACCCATGCT
TCTTCAACTCAGCTGGCTATGGTGGATGATCAAAGAAGCAAAGCAGGAAGCATCCACAGC
AAAGTGAGCAGCTACCACGGCAGCCTCCACAGATCACGTGATGGCAGGTACACGCCCTGC
AGTTACAGAGGAATGGAGGAGAGACTACCTCATGGCAGCATGTCACGACTAACAGATCAC
TCCAGGCATAGTAGTTCTCATCGGCTCAATGAACAGTCACGACATAGCAGCATCAGAGAT
CTCAGTAATAATCCCATGACTCATATCACACATGGCACCAGCATGAATCGGGTTATTGAA
GAAGATGGAACCAGTGCTTAA

Clone variation with respect to NM_017412.3
>OriGene 5' read for NM_017412 unedited
TAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGTTGATATGTTGGCCAAAT
GTGCCCCATGTAATAAAATGAAAAGAAGAGACAAGATGATGTCATTTTCCCATATTGTGA
AACCAAAAACAAACGCCTTTTGTGAGACCAAGCTAACAAACCTCTGACGGTGCGAAGAGT
ATTTAACTGTTTGAAGAATTTAACAGTAAGATACAGAAGAAGTACCTTCGAGCTGAGACC
TGCAGGTGTATAAATATCTAAAATACATATTGAATAGGCCTGATCATCTGAATCTCCTTC
AGACCCAGGAAGGATGGCTATGACTTGGATTGTCTTCTCTCTTTGGCCCTTGACTGTGTT
CATGGGGCATATAGGTGGGCACAGTTTGTTTTCTTGTGAACCTATTACCTTGAGGATGTG
CCAAGATTTGCCTTATAATACTACCTTCATGCCTAATCTTCTGAATCATTATGACCAACA
GACAGCAGCTTTGGCAATGGAGCCATTCCACCCTATGGTGAATCTGGATTGTTCTCGGGA
TTTCCGGCCTTTTCTTTGTGCACTCTACGCTCCTATTTGTATGGAATATGGACGTGTCAC
ACTTCCCTGTCGTANGCTGTGTCAGCGGGCTTACAGTGAGTGTTCGAAGCTCATGGAGAT
GTTTGGTGTTCCTTGGCCTGAAGAATGGAATGCAGTAGGTTCCCAGATTGTGATGAGCCA
TATCCTCGACTTGTGGATCTGAATNTAGCTGGAGAACCAACTGANAGAGCCCCAGTGGCA
GTGCAAAGAGACTATGGTTTTTGGTGTCCCCGAGAGTTAAAAATGATCCTGATCTGGGNT
ATTCTTTTCTGCATGTGCGTGATTGGTCACCTTCTTGTCAATATGTACTTCAAAAGAGAA
GACTGTCATTTGCTCGCTTTNCATAGGNAATGATTCATCATTTGCTCTCGGNACCATGTT
ACTTTTTAACTTTTGATGATGCACAGATCCGT
>Forward primer walk for NM_017412 unedited
TGGTTGGTACTCATCTTGACTGGCATTATATCCCTAAACATAGTTCGAATTGAGATTCCA
TTATAAATGGAGAACCAAGATAAATTAGTGAAGTTTATGATCCGGTTCGGTGTTTTCAGC
ATTCTTTATCTCGTACCACTCTTGGTTGTAATTGGATGCTACTTTTATGAGCAAGCTTAC
CGGGGCATCTGGGAAACAACGTGGATACAAGAACGCTGCAGAGAATATCACATTCCATGT
CCATATCAGGTTACTCAAATGAGTCGTCCAGACTTGATTCTCTTTCTGATGAAATACCTG
ATGGCTCTCATAGTTGGCATTCCCTCTGTATTTTGGGTTGGAAGCAAAAAGACATGCTTT
GAATGGGCCAGTTTTTTTCATGGTCGTAGGAAAAAAGAGATAGTGAATGAGAGCCGACAG
GTACTCCAGGAACCTGATTTTGCTCAGTCTCTCCTGAGGGATCCAAATACTCCTATCATA
AGAAAGTCAAGGGGAACTTCCACTCAAGGAACATCCACCCATGCTTCTTCAACTCAGCTG
GCTATGGTGGATGATCAAAGAAGCAAAGCATGAAGCATCCACAGCATAGTGAGCAGCTAC
CACGGCAGCCTCCACAGATCACGTGATGGCAGGTACACGCCCTGCAGTTACAGAGGAATG
GAGGAGAGACTACCTCATGGCAGCATGTCACGACTAACAGATCACTCCCAGCATAGTAGT
TCTCATCGGCTCAATGAACAGTCACGACATAGCAGCATCAGAGATCCTCAGTATAATCCC
ATGACTCATATCACACATGGCACCAGCATGAATCGGGTTATTGAAAGAGATGGAACCAGT
NGCTNAATTNGNNCTGNCTAAAGGAGGAAATCTGGTGCTGNTTAAAAAAGCAGATTTATT
CCTTGNCTTTTGCATGACTGATAGCTGGTACTNACAAGTAACATGCTTTCAGTCAAGT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_017412
ORF Size 2001 bp
Insert Size 3900
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_017412.2, NP_059108
RefSeq Size 3933
RefSeq ORF 2001
Locus ID 7976
Cytogenetics 8p21.1
Domains FRI, Frizzled
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Basal cell carcinoma, Colorectal cancer, Melanogenesis, Pathways in cancer, Wnt signaling pathway
Gene Summary This gene is a member of the frizzled gene family. Members of this family encode seven-transmembrane domain proteins that are receptors for the wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. The function of this protein is unknown, although it may play a role in mammalian hair follicle development. Alternative splicing results in multiple transcript variants. This gene is a susceptibility locus for schizophrenia. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.

Citations (2)

Other Versions

Other products for "FZD3"
Frequently bought together (2)
Rabbit polyclonal anti-FZD3 antibody
    • 100 ul

USD 335.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 Vial

USD 430.00

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones