p18 INK4c(CDKN2C) (NM_001262) Human Untagged Clone

CAT#: SC107906

CDKN2C (untagged)-Human cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) (CDKN2C), transcript variant 1

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name p18 INK4c(CDKN2C) (NM_001262) Human Untagged Clone
Symbol CDKN2C
Synonyms INK4C; p18; p18-INK4C
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC107906 sequence for NM_001262 edited (data generated by NextGen Sequencing)
ATGGCCGAGCCTTGGGGGAACGAGTTGGCGTCCGCAGCTGCCAGGGGGGACCTAGAGCAA
CTTACTAGTTTGTTGCAAAATAATGTAAACGTCAATGCACAAAATGGATTTGGAAGGACT
GCGCTGCAGGTTATGAAACTTGGAAATCCCGAGATTGCCAGGAGACTGCTACTTAGAGGT
GCTAATCCCGATTTGAAAGACCGAACTGGTTTCGCTGTCATTCATGATGCGGCCAGAGCA
GGTTTCCTGGACACTTTACAGACTTTGCTGGAGTTTCAAGCTGATGTTAACATCGAGGAT
AATGAAGGGAACCTGCCCTTGCACTTGGCTGCCAAAGAAGGCCACCTCCGGGTGGTGGAG
TTCCTGGTGAAGCACACGGCCAGCAATGTGGGGCATCGGAACCATAAGGGGGACACCGCC
TGTGATTTGGCCAGGCTCTATGGGAGGAATGAGGTTGTTAGCCTGATGCAGGCAAACGGG
GCTGGGGGAGCCACAAATCTTCAATAA

Clone variation with respect to NM_001262.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001262 unedited
NNNNGGGAGANCNNCNNACCCTCCCCCCCCCCCGGTTCAGAATTTGTNATACGACTCACT
ATAGGCGGCCGCGCGCATCACTCTCCTTCCTCGGGCTGCCGGGAGTCCCGGGACCTGGCG
GGGCCGGCATGACGGGCTTCTCGGGGGCCCGCCGCACGCCCGGCAGCCTCCGGAGACGCG
CGCCGAGCCCGGCTCCCACGGCCTCTGAGGCTCGGCGGGGCTGCGGCTGCCTGGCGGGCG
GGCTCCGGAGCTTTCCTGAGCGGCATTAGCCCACGGCTTGGCCCGGACGCGACCAAAGGC
TCTTCTGGAGAAGCCCAGAGCACTGGGCAATCGTTACGACCTGTAACTTGAGGGCCACCG
AACTGCTACTCCCGTTCGCCTTTGGCGATCATCTTTTAACCCTCCGGAGCACGTCAGCAT
CCAGCCACCGCGGCGCTCTCCCAGCAGCGGAGGACCCAGGACTATCCCTTCGGCGAGACG
GATGGAAACCGAGCCCCCTGGAGGACCTGCCCCTGCAGTTCTGCCTCACACGGCTCAAGT
CACCACCGTGAACAAGGGACCCTAAAGAATGGCCGAGCCTTGGGGGAACGAGTTGGCGTC
CGCAGCTGCCAGGGGGGACCTAGAGCAACTTACTANGTTTGGTGCANAATAATGTAAACG
TCAATGCACAAAATGGATNTGGAAGGACTGCGCTGCAGGTTATGAAACTTGGAAATCCCG
AGATTGCCAGGAGACTGCTACTTTANAGGTGCTAAATCCCGATTTGAAAGACCGAACTGG
GTTTCGCTGTCATTCATGATGCGGGCANAGCAGGTTTCCCTGGACACTTTACAGACCTTG
CTGGGAGTTTCAAGCTGATGGTAACCTCGAGGATAATGGAAGGGAACCTGCCCTTGCACT
TGGCTGCCAAAGAAGCCACTCCGGCTGGGGGGGAGGTCCCTGTGGAACC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_001262 unedited
NNGGGTTTACTATGNACCGCGCCGCAATCTANGATCGGTTTTTTTTTTTTTTTTTTCCTG
TTTTGAAGTGTTTTAATTAGACAAAAGCATCAGGACAAACCATTTTAAAAACAAAGTCTT
CAACTTGGGTGTTGAGATTGGCAAAAGGGGAAGCAAGGGAAAAGCCAAGGAAAGATAAAA
TATTCAGAAGAAAGTCAAAGTTATCTGCAATTACATGTTAGAACAGATTTTGCAGGTTAA
AAAGATGTTGCTTAAATATATTCATAAGCCTGTTGTAAGATTTTCACTTATGCAGTTTCA
GAAAATTTAGCTGCTTAACATATGACAGAACTGTATTTTAACAAATGACATTAAAAGTCA
GGAGAGCTACTCAGTTAATTGATAAAGTAGAGGCAACGTGGGGGAGCCCTCCCCACGTTT
ATTGAAGATTTGTGGCTCCCCCAGCCCCGTTTGCCTGCATCAGGCTAACAACCTCATTCC
TCCCATAGAGCCTGGCCAAATCACAGGCGGTGTCCCCCTTATGGTTCCGATGCCCCACAT
TGCTGGCCGTGTGCTTCACCAGGAACTCCACCACCCGGAGGTGGCCTTCTTTGGCAGCCA
AGTGCAAGGGCAGGTTCCCTTCATTATCCTCGATGTTAACATCAGCTTGAAACTCCAGCA
AAGTCTGTAAAGTGTCCAGGAAACCTGCTCTGGCCGCATCATGAATGACAGCGAAACCAG
TTCGGTCTTTCAAATCGGGATTAGCACCTCTAAGTAGCAGTCTCCTGGGCATCTCGGGAT
TTCCAAGTTTTATAACCTGCAGCGCAGTCCTTCCAAATCCATTTTGTGCATTGACGTTTA
CATTATTTTGCAACAAACTAGTAAGTTGCTCCG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001262
ORF Size 507 bp
Insert Size 1500
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001262.2, NP_001253
RefSeq Size 2104
Locus ID 1031
Cytogenetics 1p32.3
Protein Families Druggable Genome
Protein Pathways Cell cycle
Gene Summary The protein encoded by this gene is a member of the INK4 family of cyclin-dependent kinase inhibitors. This protein has been shown to interact with CDK4 or CDK6, and prevent the activation of the CDK kinases, thus function as a cell growth regulator that controls cell cycle G1 progression. Ectopic expression of this gene was shown to suppress the growth of human cells in a manner that appears to correlate with the presence of a wild-type RB1 function. Studies in the knockout mice suggested the roles of this gene in regulating spermatogenesis, as well as in suppressing tumorigenesis. Two alternatively spliced transcript variants of this gene, which encode an identical protein, have been reported. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (1) contains a different 5' UTR region, and encodes an identical protein, when compared to variant 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.