AJUBA (NM_198086) Human Untagged Clone

SKU
SC107745
AJUBA (untagged)-Human jub, ajuba homolog (Xenopus laevis) (JUB), transcript variant 2
$150.00
4 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol AJUBA
Synonyms JUB
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_198086, the custom clone sequence may differ by one or more nucleotides


ATGGGGAAGTCCTATCATCCAGGCTGTTTCCGATGCATTGTTTGCAACAAGTGCCTGGATGGCATCCCCT
TCACAGTGGACTTCTCCAACCAAGTATACTGTGTCACCGACTACCACAAAAATTATGCTCCTAAGTGTGC
AGCCTGTGGCCAACCCATCCTCCCCTCTGAGGGCTGTGAGGACATCGTGAGGGTGATATCCATGGACCGG
GATTATCACTTTGAGTGCTACCACTGTGAGGACTGCCGGATGCAGCTGAGTGATGAGGAAGGCTGCTGCT
GTTTCCCTCTGGATGGGCACTTGCTCTGCCATGGTTGCCACATGCAGCGGCTCAATGCCCGACAACCCCC
TGCCAACTATATCTGA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_198086 unedited
ATTCGGCACGAGCGTGAGGGTGATATCCATGGACCGGGATTATCACTTTGAGTGCTACCA
CTGTGAGGACTGCCGGATGCAGCTGAGTGATGAGGAAGGCTGCTGCTGTTTCCCTCTGGA
TGGGCACTTGCTCTGCCATGGTTGCCACATGCAGCGGCTCAATGCCCGACAACCCCCTGC
CAACTATATCTGAGCTGCAATCACTGCTGCTGCTGTCACCCTGCAGACAAACTGCTGTGG
CCAGTGGGCCCCTCTGAGGCCAGCCAAGGCAAAGAATGCACTCTGCAGGCCTGGCAGAAG
AGTCCTCTGGGGAGGACCCCAAGGGCCGGAGACCCAAAGATCATGATATTCCAAATGGAT
TGTGGAAGAGAAACCTTATATTTACCAGGGTGGGGGCGACTGGCCTTTTTCCCATGTGTG
CAGTCTGAGCTTAAGCACACACAGGAGGGTTCCAGGACTTACTGAAGATACAGAATCAGA
TGTTCAGTATATATATTTTGTTTGTTTTAGAGATGGGATCTCACCATGTTGCCCAGGCTA
GTCTTGAACTCCTGNGCTCGAATGATCCTCCCACCTTGGCCTCCCAAGTGCTGGGATTAT
AGGCGTAGCCACTGTGTCTGGCCTAGTGTATGATTATGCATGAGTCACGCAATGTTCTGG
TCCTGGGATTCAGGAGTAGAGGACCTAGCTTTAGATCAATTAGTTTCAGCTAAACTGACT
GGAACCAGGTTCAAGTGTAATTCTTCCTTCAGCTCCCCCAAACCCCGAGTTTTGGGGN
Restriction Sites NotI-NotI
ACCN NM_198086
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_198086.1, NP_932352.1
RefSeq Size 3263 bp
RefSeq ORF 366 bp
Locus ID 84962
UniProt ID Q96IF1
Cytogenetics 14q11.2
Summary Adapter or scaffold protein which participates in the assembly of numerous protein complexes and is involved in several cellular processes such as cell fate determination, cytoskeletal organization, repression of gene transcription, mitosis, cell-cell adhesion, cell differentiation, proliferation and migration. Contributes to the linking and/or strengthening of epithelia cell-cell junctions in part by linking adhesive receptors to the actin cytoskeleton. May be involved in signal transduction from cell adhesion sites to the nucleus. Plays an important role in regulation of the kinase activity of AURKA for mitotic commitment. Also a component of the IL-1 signaling pathway modulating IL-1-induced NFKB1 activation by influencing the assembly and activity of the PRKCZ-SQSTM1-TRAF6 multiprotein signaling complex. Functions as an HDAC-dependent corepressor for a subset of GFI1 target genes. Acts as a transcriptional corepressor for SNAI1 and SNAI2/SLUG-dependent repression of E-cadherin transcription. Acts as a hypoxic regulator by bridging an association between the prolyl hydroxylases and VHL enabling efficient degradation of HIF1A. Positively regulates microRNA (miRNA)-mediated gene silencing. Negatively regulates the Hippo signaling pathway and antagonizes phosphorylation of YAP1.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus than isoform 1.
Write Your Own Review
You're reviewing:AJUBA (NM_198086) Human Untagged Clone
Your Rating
SKU Description Size Price
RC215384 AJUBA (Myc-DDK-tagged)-Human jub, ajuba homolog (Xenopus laevis) (JUB), transcript variant 2 10 ug
$502.00
RC215384L3 Lenti ORF clone of Human jub, ajuba homolog (Xenopus laevis) (JUB), transcript variant 2, Myc-DDK-tagged 10 ug
$802.00
RC215384L4 Lenti ORF clone of Human jub, ajuba homolog (Xenopus laevis) (JUB), transcript variant 2, mGFP tagged 10 ug
$802.00
RG215384 AJUBA (tGFP-tagged) - Human jub, ajuba homolog (Xenopus laevis) (JUB), transcript variant 2 10 ug
$489.00 MSRP $702.00 MSRP $702.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.