PAMM (FAM213A) (NM_032333) Human Untagged Clone

CAT#: SC105291

Reviews ()
Write a review

FAM213A (untagged)-Human chromosome 10 open reading frame 58 (C10orf58), transcript variant 1



  "NM_032333" in other vectors (6)

Reconstitution Protocol

USD 300.00


Availability*
In Stock

Size
    • 10 ug


Product images

Other products for "PRXL2A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PRXL2A
Synonyms Adrx; C10orf58; FAM213A; PAMM
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC105291 sequence for NM_032333 edited (data generated by NextGen Sequencing)
ATGTCTTTCCTCCAGGACCCAAGTTTCTTCACCATGGGGATGTGGTCCATTGGTGCAGGA
GCCCTGGGGGCTGCTGCCTTGGCATTGCTGCTTGCCAACACAGACGTGTTTCTGTCCAAG
CCCCAGAAAGCGGCCCTGGAGTACCTGGAGGATATAGACCTGAAAACACTGGAGAAGGAA
CCAAGGACTTTCAAAGCAAAGGAGCTATGGGAAAAAAATGGAGCTGTGATTATGGCCGTG
CGGAGGCCAGGCTGTTTCCTCTGTCGAGAGGAAGCTGCGGATCTGTCCTCCCTGAAAAGC
ATGTTGGACCAGCTGGGCGTCCCCCTCTATGCAGTGGTAAAGGAGCACATCAGGACTGAA
GTGAAGGATTTCCAGCCTTATTTCAAAGGAGAAATCTTCCTGGATGAAAAGAAAAAGTTC
TATGGTCCACAAAGGCGGAAGATGATGTTTATGGGATTTATCCGTCTGGGAGTGTGGTAC
AACTTCTTCCGAGCCTGGAACGGAGGCTTCTCTGGAAACCTGGAAGGAGAAGGCTTCATC
CTTGGGGGAGTTTTCGTGGTGGGATCAGGAAAGCAGGGCATTCTTCTTGAGCACCGAGAA
AAAGAATTTGGAGACAAAGTAAACCTACTTTCTGTTCTGGAAGCTGCTAAGATGATCAAA
CCACAGACTTTGGCCTCAGAGAAAAAATGA

Clone variation with respect to NM_032333.4
>OriGene 5' read for NM_032333 unedited
NGGTCAACATTTGTATACGACTCCTATAGGGCGGCCGCGAATTCGCACGAGGGTCGGGGC
GGTAAAAGGCCGGCAGAAGGGAGGCACTTGAGAAAGTCTTTCCTCCAGGACCCAAGTTTC
TTCACCATGGGGATGTGGTCCATTGGTGCAGGAGCCCTGGGGGCTGCTGCCTTGGCATTG
CTGCTTGCCAACACAGACGTGTTTCTGTCCAAGCCCCAGAAAGCGGCCCTGGAGTACCTG
GAGGATATAGACCTGAAAACACTGGAGAAGGAACCAAGGACTTTCAAAGCAAAGGAGCTA
TGGGAAAAAAATGGAGCTGTGATTATGGCCGTGCGGAGGCCAGGCTGTTTCCTCTGTCGA
GAGGAAGCTGCGGATCTGTCCTCCCTGAAAAGCATGTTGGACCAGCTGGGCGTCCCCCTC
TATGCAGTGGTAAAGGAGCACATCAGGACTGAAGTGAAGGATTTCCAGCCTTATTTCAAA
GGAGAAATCTTCCTGGATGAAAAGAAAAAGTTCTATGGTCCACAAAGGCGGAAGATGATG
TTTATGGGATTTATCCGTCTGGGAGTGTGGTACAACTTCTTCCGAGCCTGGAACGGAGGC
TTCTCTGGAAACCTGGAAGGAGAAGGCTTCATCCTTGGGGGAGTTTTCGTGGTGGGATCA
GGAAAGCAGGGCATTCTTCTTGAGCACCGAGAAAAAGAATTTGGAGACAAAGTAAACCTA
CTTTCTGTTCTGGAAGCTGCTAAGATGATCAAACCACAGACTNTGGCCTCAGAGAAAAAT
GATTGTGTGAAACTGCCCAGCTCAGGGATAACCAGNGCATTCACCTGTGTCATGGGAATG
NNATGNTTCCACTCGTGTCCTTNAGGAGTGAGAACCCATTATACTCTACTTANNATGATT
AT
>OriGene 3' read for NM_032333 unedited
CTTGGCCGCGGCCGCATCTAAATCGGTTTTTTTTTTTTTTTTTTATTAGATCTCATCACC
CAGCTGGAATACAGTGGTGCGATCTCAGCTCACCGCAACCTCCACCTCCCAGGTTCAAGT
GATTCTCCTGCCTCAGCCTCCCGGGTAGCTGGGACCACAGGTGCCTGCCACCACACCCGG
GTGATTTTTGTATTTTTAGTAGAGACGGGGTTTCGCCATGTTGCTCAGGCTGGTCTCGAA
CTCCCGACCTCAAGTGACTTGCTCACCTTGGCCTCCCAAAGTGCTGGGATTACAGGTGTG
AGCCACTGCACCCAGCCTGGCAGTCAATTTTAAGCCTCCTATTTCCCAGGTTTTAGCTTA
ATAATCCTCATTAGTTTTTCAGATTTTTGCCAGTTTTGTTTTGGGGCTATTTTGCCTTAG
TGGGCCTAAACAGAATATTAAAATACATTAATAATCCATACTGACAGTAGAGTCTAAATG
GGTTTCTCACTCCTTAGGGACCCGAGTGGAAACCATACTTCCCATGACACCAGGGAATGC
CCCTGGCTACCCCTGACCGGGCAGTTGGCCCAATCATTTTTTCTCTGAGGCCCAACCCGC
GGCTTGCCCTCTTCACCCCTTCCCCAACAAAACCAGGTGCCTTTCGCGCAAACCGTTCCG
CGCGCGCTCAAAACATGCCGCGCTTCCCTCCCCCCGGTGCGGAACTTCCCCCCGCTCCCC
CCTTCTCTCCTATCTTCCCCCCCCCCCCCCCCCCCCTCCGTGTATCTCCCCTGCCCCCCC
CTCACCTCCCCGCATTACCTCCACCTTCTCGCGCAGCGCCCACCTTCTCCCTTATCTTCC
CCTTCGCTTGGCTCGTTCTTTCCCTACCCGGCCCCGCCGCTCCCATTCTCTCGCCTGCCC
CTCCCCTGCCTCCATCCCTCCCCCCCCCCTCCCCCCCCCTCCTT
Restriction Sites NotI-NotI     
ACCN NM_032333
Insert Size 1100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_032333.2, NP_115709.2
RefSeq Size 1690 bp
RefSeq ORF 690 bp
Locus ID 84293
UniProt ID Q9BRX8
Cytogenetics 10q23.1
Protein Families Secreted Protein, Transmembrane
Gene Summary Involved in redox regulation of the cell (PubMed:26438880, PubMed:19951071). Acts as an antioxidant (PubMed:19951071, PubMed:26438880). Inhibits TNFSF11-induced NFKB1 and JUN activation and osteoclast differentiation (PubMed:19951071). May affect bone resorption and help to maintain bone mass (PubMed:19951071). Acts as a negative regulator of macrophage-mediated inflammation by inhibiting macrophage production of inflammatory cytokines, probably through suppression of the MAPK signaling pathway (PubMed:26438880).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes isoform 1. Variants 1, 2, 3 and 4 encode the same isoform.

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.