Cytochrome P450 2D6 (CYP2D6) (NM_000106) Human Untagged Clone

CAT#: SC104446

Reviews ()
Write a review

CYP2D6 (untagged)-Human cytochrome P450, family 2, subfamily D, polypeptide 6 (CYP2D6), transcript variant 1



  "NM_000106" in other vectors (4)

Reconstitution Protocol

USD 457.00


Availability*
In Stock

Size
    • 10 ug


Product images

Other products for "CYP2D6"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CYP2D6
Synonyms CPD6; CYP2D; CYP2D7AP; CYP2D7BP; CYP2D7P2; CYP2D8P2; CYP2DL1; CYPIID6; P450-DB1; P450C2D; P450DB1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_000106 edited
TCGGCACGAGGCCTGGTCCTCTGTGCCTGGTGGGGTGGGGGTGCCAGGTGTGTCCAGAGG
AGCCCATTTGGTAGTGAGGCAGGTATGGGGCTAGAAGCACTGGTGCCCCTGGCCGTGATA
GTGGCCATCTTCCTGCTCCTGGTGGACCTGATGCACCGGCGCCAACGCTGGGCTGCACGC
TACTCACCAGGCCCCCTGCCACTGCCCGGGCTGGGCAACCTGCTGCATGTGGACTTCCAG
AACACACCATACTGCTTCGACCAGTTGCGGCGCCGCTTCGGGGACGTGTTCAGCCTGCAG
CTGGCCTGGACGCCGGTGGTCGTGCTCAATGGGCTGGCGGCCGTGCGCGAGGCGCTGGTG
ACCCACGGCGAGGACACCGCCGACCGCCCGCCTGTGCCCATCACCCAGATCCTGGGTTTT
GGGCCGCGTTCCCAAGGGGTGTTCCTGGTGCGCTATGGGCCCGCGTGGCGCGAGCAGAGG
CGCTTCTCCGTCTCCACCTTGCGCAACTTGGGCCTGGGCAAGAAGTCGCTGGAGCAGTGG
GTGACCGAGGAGGCCGCCTGCCTTTGTGCCGCCTTCGCCAACCACTCCGGACGCCCCTTT
CGCCCCAACGGTCTCTTGGACAAAGCCGTGAGCAACGTGATCGCCTCCCTCACCTGCGGG
CGCCGCTTCGAGTACGACGACCCTCGCTTCCTCAGGCTGCTGGACCTAGCTCAGGAGGGA
CTGAAGGAGGAGTCGGGCTTTCTGCGCGAGGTGCTGAATGCTGTCCCCGTCCTCCTGCAT
ATCCCAGCGCTGGCTGGCAAGGTCCTACGCTTCCAAAAGGCTTTCCTGACCCAGCTGGAT
GAGCTGCTAACTGAGCACAGGATGACCTGGGACCCAGCCCAGCCCCCCCGAGACCTGACT
GAGGCCTTCCTGGCAGAGATGGAGAAGGCCAAGGGGAACCCTGAGAGCAGCTTCAATGAT
GAGAACCTGCGCATAGTGGTGGCTGACCTGTTCTCTGCCGGGATGGTGACCACCTCGACC
ACGCTGGCCTGGGGCCTCCTGCTCATGATCCTACATCCGGATGTGCAGCGCCGTGTCCAA
CAGGAGATCGACGACGTGATAGGGCAGGTGCGGCGACCAGAGATGGGTGACCAGGCTCAC
ATGCCCTACACCACTGCCGTGATTCATGAGGTGCAGCGCTTTGGGGACATCGTCCCCCTG
GGTGTGACCCATATGACATCCCGTGACATCGAAGTACAGGGCTTCCGCATCCCTAAGGGA
ACGACACTCATCACCAACCTGTCATCGGTGCTGAAGGATGAGGCCGTCTGGGAGAAGCCC
TTCCGCTTCCACCCCGAACACTTCCTGGATGCCCAGGGCCACTTTGTGAAGCCGGAGGCC
TTCCTGCCTTTCTCAGCAGGCCGCCGTGCATGCCTCGGGGAGCCCCTGGCCCGCATGGAG
CTCTTCCTCTTCTTCACCTCCCTGCTGCAGCACTTCAGCTTCTCGGTGCCCACTGGACAG
CCCCGGCCCAGCCACCATGGTGTCTTTGCTTTCCTGGTGACCCCATCCCCCTATGAGCTT
TGTGCTGTGCCCCGCTAGAATGGGGTACCTAGTCCCCAGCCTGCTCCCTAGCCAGAGGCT
CTAATGTACAA
>OriGene 5' read for NM_000106 unedited
NNNNNGGGGGNNNNNNCCCCCCNNGGNNCGGTTCAGATTTGTATACGACTCACTATAGGC
GGCCGCGATTCGGCACGAGGCCTGGTCCTCTGTGCCTGGTGGGGTGGGGGTGCCAGGTGT
GTCCAGAGGAGCCCATTTGGTAGTGAGGCAGGTATGGGGCTAGAAGCACTGGTGCCCCTG
GCCGTGATAGTGGCCATCTTCCTGCTCCTGGTGGACCTGATGCACCGGCGCCAACGCTGG
GCTGCACGCTACTCACCAGGCCCCCTGCCACTGCCCGGGCTGGGCAACCTGCTGCATGTG
GACTTCCAGAACACACCATACTGCTTCGACCAGTTGCGGCGCCGCTTCGGGGACGTGTTC
AGCCTGCAGCTGGCCTGGACGCCGGTGGTCGTGCTCAATGGGCTGGCGGCCGTGCGCGAG
GCGCTGGTGACCCACGGCGAGGACACCGCCGACCGCCCGCCTGTGCCCATCACCCAGATC
CTGNGTTTTGGGCCGCGTTCCCAAGGGGTGTTCCTGGTGCGCTATGGGCCCGCGTGGCGC
GAGCAGAGGCGCTTCTCCGTCTCCACCTTGCGCAACTTGGGCCTGGGCAAGAAGTCGCTG
GAGCAGTGGGTGACCGAGGAGGCCGCCTGCCTTTGTGCCGCCTTCGCCAACCACTCCGGA
CGCCCCTTTCGCCCCAACGGTCTCTTGGACAAAGCCGTGAGCAACGTGATCGCCTTCCTC
ACCTGCGGGCGCCGCTTCGAGTACGACGACCCTCGCTTCCTCAGGCTGCTGGACCTAGCT
CANGAGGGNACTGAGNGANGAGTCGGGCTTTCTGNCGCGAGGTGCTGAAATGCTGTCCCC
GTCCTTCTGCATATCCCAGCGCTGGCTGGNNCAGGTCCTACGCTTCCAAAGGCTTNTCTG
ACCCANCTGNATGAGCTGCTACTGAGCCAGGATGACCTGGGN
>OriGene 3' read for NM_000106 unedited
NNTTTTACTCTGNAACCGCGGCCGCAATCTAANGATCGATTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTTTGGAACTACCACATTGCTTTATTGGACATTAAAACCTCTGGC
TAAGGAACAAGCTGGGGACTAAGTACCCCATTTTAACGGGGCACAACACAAAACTCATAA
GGGGATGGGGTCACCAAGAAAGCAAAAACACCCTGGGGGCTGGGCCCGGGCTGTCCAATG
GGCACCCAAAAACTTAAATGCTTCACCAGGGAGGGGAAAAAAAAGAAAAACTCCATGCGG
GCCAAGGGCTCCCCCAAGCATGCACCGGGGCCTGCTTAAAAAAGCAAGAAAGCCTCCCGC
TTTACAAAATGGCCCTGGGCATTCAAAAAATGTTCCGGGTGGAAACCGAAAGGGTTTTTC
CAAAAGGGCTTATTCTTTAACACCCAAAAAAAGTTGGGGAAGAATGTCCTTCCCTTAAGG
AAGCGGAAACCCTGTACTTTGATGTCACGGGATGTCATATGGGTCACACCCAAGGGGACC
ATGTCCCCAAAACGCTGCACCTCATGAATCACCGCAATGGTGTAAGGCATGTGAACCTGG
TCACCCATTTTTGGTCGCCGCACCTGCCCTATTACGTTGTCGATCTCCTGTTGGACACCG
GGCTTCACATTCCGATGTAAGATCATTAACAAGAAGCCCCAAGCCAACGTGGGTCGAAGT
GGTCACCATTCCGGCAGAGAACAGGTCAACCACCACTATGCCGCAAGGTCTCATCATTGA
AACTGCTCTTCAAGGGTTCCCTTGGCCTTCTTCATCTCTGCCAGAAAGCCTTAATCAGTC
TCCGGGGGGGCCTGGGCCTGTGTCCAAGTCATCCTGGCCTCAATTAACACTATTCAGCTG
GGGTCAGAAAGCCTTTTGGAAACCTAAGACCCTGCCAACACGCTGAATTCCCCAAGAAAC
GA
Restriction Sites NotI-NotI     
ACCN NM_000106
Insert Size 2000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000106.4, NP_000097.2
RefSeq Size 1673 bp
RefSeq ORF 1494 bp
Locus ID 1565
UniProt ID P10635
Cytogenetics 22q13.2
Domains p450
Protein Families Druggable Genome, P450, Transmembrane
Protein Pathways Drug metabolism - cytochrome P450
Gene Summary This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is known to metabolize as many as 25% of commonly prescribed drugs. Its substrates include antidepressants, antipsychotics, analgesics and antitussives, beta adrenergic blocking agents, antiarrythmics and antiemetics. The gene is highly polymorphic in the human population; certain alleles result in the poor metabolizer phenotype, characterized by a decreased ability to metabolize the enzyme's substrates. Some individuals with the poor metabolizer phenotype have no functional protein since they carry 2 null alleles whereas in other individuals the gene is absent. This gene can vary in copy number and individuals with the ultrarapid metabolizer phenotype can have 3 or more active copies of the gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (1) encodes the longer isoform (1).

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.