FAK(PTK2) (NM_153831) Human Untagged Clone

CAT#: SC101236

PTK2 (untagged)-Human PTK2 protein tyrosine kinase 2 (PTK2), transcript variant 1

USD 2,019


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name FAK(PTK2) (NM_153831) Human Untagged Clone
Symbol PTK2
Synonyms FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_153831 edited
ATGGCAGCTGCTTACCTTGACCCCAACTTGAATCACACACCAAATTCGAGTACTAAGACT
CACCTGGGTACTGGTATGGAACGTTCTCCTGGTGCAATGGAGCGAGTATTAAAGGTCTTT
CATTATTTTGAAAGCAATAGTGAGCCAACCACCTGGGCCAGTATTATCAGGCATGGAGAT
GCTACTGATGTCAGGGGCATCATTCAGAAGATAGTGGACAGTCACAAAGTAAAGCATGTG
GCCTGCTATGGATTCCGCCTCAGTCACCTGCGGTCAGAGGAGGTTCACTGGCTTCACGTG
GATATGGGCGTCTCCAGTGTGAGGGAGAAGTATGAGCTTGCTCACCCACCAGAGGAGTGG
AAATATGAATTGAGAATTCGTTATTTGCCAAAAGGATTTCTAAACCAGTTTACTGAAGAT
AAGCCAACTTTGAATTTCTTCTATCAACAGGTGAAGAGCGATTATATGTTAGAGATAGCT
GATCAAGTGGACCAGGAAATTGCTTTGAAGTTGGGTTGTCTAGAAATACGGCGATCATAC
TGGGAGATGCGGGGCAATGCACTAGAAAAGAAGTCTAACTATGAAGTATTAGAAAAAGAT
GTTGGTTTAAAGCGATTTTTTCCTAAGAGTTTACTGGATTCTGTCAAGGCCAAAACACTA
AGAAAACTGATCCAACAAACATTTAGACAATTTGCCAACCTTAATAGAGAAGAAAGTATT
CTGAAATTCTTTGAGATCCTGTCTCCAGTCTACAGATTTGATAAGGAATGCTTCAAGTGT
GCTCTTGGTTCAAGCTGGATTATTTCAGTGGAACTGGCAATCGGCCCAGAAGAAGGAATC
AGTTACCTAACGGACAAGGGCTGCAATCCCACACATCTTGCTGACTTCACTCAAGTGCAA
ACCATTCAGTATTCAAACAGTGAAGACAAGGACAGAAAAGGAATGCTACAACTAAAAATA
GCAGGTGCACCCGAGCCTCTGACAGTGACGGCACCATCCCTAACCATTGCGGAGAATATG
GCTGACCTAATAGATGGGTACTGCCGGCTGGTGAATGGAACCTCGCAGTCATTTATCATC
AGACCTCAGAAAGAAGGTGAACGGGCTTTGCCATCAATACCAAAGTTGGCCAACAGCGAA
AAGCAAGGCATGCGGACACACGCCGTCTCTGTGTCAGAAACAGATGATTATGCTGAGATT
ATAGATGAAGAAGATACTTACACCATGCCCTCAACCAGGGATTATGAGATTCAAAGAGAA
AGAATAGAACTTGGACGATGTATTGGAGAAGGCCAATTTGGAGATGTACATCAAGGCATT
TATATGAGTCCAGAGAATCCAGCTTTGGCGGTTGCAATTAAAACATGTAAAAACTGTACT
TCGGACAGCGTGAGAGAGAAATTTCTTCAAGAAGCCTTAACAATGCGTCAGTTTGACCAT
CCTCATATTGTGAAGCTGATTGGAGTCATCACAGAGAATCCTGTCTGGATAATCATGGAG
CTGTGCACACTTGGAGAGCTGAGGTCATTTTTGCAAGTAAGGAAATACAGTTTGGATCTA
GCATCTTTGATCCTGTATGCCTATCAGCTTAGTACAGCTCTTGCATATCTAGAGAGCAAA
AGATTTGTACACAGGGACATTGCTGCTCGGAATGTTCTGGTGTCCTCAAATGATTGTGTA
AAATTAGGAGACTTTGGATTATCCCGATATATGGAAGATAGTACTTACTACAAAGCTTCC
AAAGGAAAATTGCCTATTAAATGGATGGCTCCAGAGTCAATCAATTTTCGACGTTTTACC
TCAGCTAGTGACGTATGGATGTTTGGTGTGTGTATGTGGGAGATACTGATGCATGGTGTG
AAGCCTTTTCAAGGAGTGAAGAACAATGATGTAATCGGTCGAATTGAAAATGGGGAAAGA
TTACCAATGCCTCCAAATTGTCCTCCTACCCTCTACAGCCTTATGACGAAATGCTGGGCC
TATGACCCCAGCAGGCGGCCCAGGTTTACTGAACTTAAAGCTCAGCTCAGCACAATCCTG
GAGGAAGAGAAGGCTCAGCAAGAAGAGCGCATGAGGATGGAGTCCAGAAGACAGGCCACA
GTGTCCTGGGACTCCGGAGGGTCTGATGAAGCACCGCCCAAGCCCAGCAGACCGGGTTAT
CCCAGTCCGAGGTCCAGCGAAGGATTTTATCCCAGCCCACAGCACATGGTACAAACCAAT
CATTACCAGGTTTCTGGCTACCCTGGTTCACATGGAATCACAGCCATGGCTGGCAGCATC
TATCCAGGTCAGGCATCTCTTTTGGACCAAACAGATTCATGGAATCATAGACCTCAGGAG
ATAGCAATGTGGCAGCCCAATGTGGAGGACTCTACAGTATTGGACCTGCGAGGGATTGGG
CAAGTGTTGCCAACCCATCTGATGGAAGAGCGTCTAATCCGACAGCAACAGGAAATGGAA
GAAGATCAGCGCTGGCTGGAAAAAGAGGAAAGATTTCTGAAACCTGATGTGAGACTCTCT
CGAGGCAGTATTGACAGGGAGGATGGAAGTCTTCAGGGTCCGATTGGAAACCAACATATA
TATCAGCCTGTGGGTAAACCAGATCCTGCAGCTCCACCAAAGAAACCGCCTCGCCCTGGA
GCTCCCGGTCATCTGGGAAGCCTTGCCAGCCTCAGCAGCCCTGCTGACAGCTACAACGAG
GGTGTCAAGCCATGGAGGCTTCAGCCCCAGGAAATCAGCCCCCCTCCTACTGCCAACCTG
GACCGGTCGAATGATAAGGTGTACGAGAATGTGACGGGCCTGGTGAAAGCTGTCATCGAG
ATGTCCAGTAAAATCCAGCCAGCCCCACCAGAGGAGTATGTCCCTATGGTGAAGGAAGTC
GGCTTGGCCCTGAGGACATTATTGGCCACTGTGGATGAGACCATTCCCCTCCTACCAGCC
AGCACCCACCGAGAGATTGAGATGGCACAGAAGCTATTGAACTCTGACCTGGGTGAGCTC
ATCAACAAGATGAAACTGGCCCAGCAGTATGTCATGACCAGCCTCCAGCAAGAGTACAAA
AAGCAAATGCTGACTGCTGCTCACGCCCTGGCTGTGGATGCCAAAAACTTACTCGATGTC
ATTGACCAAGCAAGACTGAAAATGCTTGGGCAGACGAGACCACACTGAGCCTCCCCTAGG
AGCACGTCTTGCTACCCTCTTTTGAAGATGTTCTCTAGCCTTCCACCAGCAGCGAGGAAT
TAACCCTGTGTCCTCAGTCGCCAGCACTTACAGCTCCAACTTTTTTGAATGACCATCTGG
TTGAAAAATCTTTCTCATATAAGTTTAACCACACTTTGATTTGGGTTCATTTTTTGTTTT
GTTTTTTTCAATCATGATATTCAGAAAAATCCAGGATCCAAAATGTGGCGTTTTTCTAAG
AATGAAAATTATATGTAAGCTTTTAAGCATCATGAAGAACAATTTATGTTCACATTAAGA
TACGTTCTAAAGGGGGATGGCCAAGGGGTGACATCTTAATTCCTAAACTACCTTAGCTGC
ATAGTGGAAGAGGAGAGCATGAAGCAAAGAATTCCAGGAAACCCAAGAGGCTGAGAATTC
TTTTGTCTACCATAGAATTATTATCCAGACTGGAATTTTTGTTTGTTAGAACACCCTTCA
GTTGCAATATGCTAATCCCACTTTACAAAGAATATAAAAGCTATATTTTGAAGACTTGAG
TTATTTCAGAAAAAACTACAGCCCTTTTTGTCTTACCTGCCTTTTACTTTCGTGTGGATA
TGTGAAGCATTGGGTCGGGAACTAGCTGTAGAACACAACTAAAAACTCATGTCTTTTTTC
ACAGAATAATGTGCCAGTTTTTTGTAGCAATGATATTTCTCTTGGAAGCAGAAATGCTTT
GTACCAGAGCACCTCCAAACTGCATTGAGGAGAAGTTCCAGAACCATCCCCTTTTTCCAT
TTTTATATAATTTATAAAGAAAGATTAAAGCCATGTTGACTATTTTACAGCCACTGGAGT
TAACTAACCCTTCCTTGTATCTGTCTTCCCAGGAGAGAATGAAGCAAAACAGGAATTTGG
TTTTCTTTTGATGTCCAGTTACACCATCCATTCTGTTAATTTTGAAAAAATATACCCTCC
CTTTAGTTTGTTGGGGGATATAAATTATTCTCAGGAAGAATATAATGAACTGTACAGTTA
CTTTGACCTATTAAAAAGGTGTTACCAGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAACTCGACTCTAGATTGCGGCCGCGGTCATAGCTGTTTCCTGAACAGATCCCGG
GTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCAC
5' Read Nucleotide Sequence
>OriGene 5' read for NM_153831 unedited
AATCTGGGATTTGTAAACGACTTACTATAGGCGGCACGCGCGCCGGCCGCGGTCCGAGCA
GAACTGGGGCTCCCTTGCATCTTCCAGTTACAAATTCAGTGCCTTCTGCAGTTTCCCCAG
AGCTCCTCAAGAATAACGGAAGGGAGAATATGACAGATACCTAGCATCTAGCAAAATAAT
GGCAGCTGCTTACCTTGACCCCAACTTGAATCACACACCAAATTCGAGTACTAAGACTCA
CCTGGGTACTGGTATGGAACGTTCTCCTGGTGCAATGGAGCGAGTATTAAAGGTCTTTCA
TTATTTTGAAAGCAATAGTGAGCCAACCACCTGGGCCAGTATTATCAGGCATGGAGATGC
TACTGATGTCAGGGGCATCATTCAGAAGATAGTGGACAGTCACAAAGTAAAGCATGTGGC
CTGCTATGGATTCCGCCTCAGTCACCTGCGGTCAGAGGAGGTTCACTGGCTTCACGTGGA
TATGGGCGTCTCCAGTGTGAGGGAGAAGTATGAGCTTGCTCACCCACCAGAGGAGTGGAA
ATATGAATTGAGAATTCGTTATTTGCCAAAAGGATTTCTAAACCAGTTTACTGAAGATAA
GCCAACTTTGAATTTCTTCTATCAACAGGTGAAGAGCGATTATATGTTAGAGATAGCTGA
TCAAGTGGACCANGAAATTGCTTTGAAGTTGGGTTGTCTAGAAATACGGCGATCATACTG
GGAGATGCGGGGCAATGCACTAGANAAAGAAGTCTACTATGAAGTATTAGAAAAAAGATG
TGGGTTAAAAGCGATTTTTCCTAAGAGTTTACTGGNATCTGTCAGGGCCAAACACTTAAA
AACTGATCCCCACAACATTTAGACAATTTGCCAACCTTNATAGAGAAGAAGTATTCCTGA
ATTCTTGG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_153831 unedited
TGTGTACCGCGCCGCATTCTANGATCGAGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTACTGGTAACACCTTTTTAATAGGTCAAAGTAACTGTACAGTTCATTATATTC
TTCCTGAAAATAATTTATATCCCCCAACAAACTAAAGGGAGGGTATATTTTTTCAAAATT
AACAAAATGGATGGTGTAACTGGACATCAAAAGAAAACCAAATTCCTGTTTTGCTTCATT
CTCTCCTGGGAAAACAGATACAAGGAAGGGTTAGTTAACTCCAGTGGCTGTAAAATAGTC
AACATGGCTTTAATCTTTCTTTATAAATTATATAAAAATGGAAAAAGGGGATGGTTCTGG
AACTTCTCCTCAATGCAGTTTGGAGGTGCTCTGGTACAAAGCATTTCTGCTTCCAAGAGA
AATATCATTGCTACAAAAAACTGGCACATTATTCTGTGAAAAAAGACATGAGTTTTTAGT
TGTGTTCTACAGCTAGTTCCCGACCCAATGCTTCACATATCCACACGAAAGTAAAAGGCA
GGTAAGACAAAAAGGGCTGTAGTTTTTTCTGAAATAACTCAAGTCTTCAAAATATAGCTT
TTATATTCTTTGTAAAGTGGGATTAGCATATTGCAACTGAAGGGTGTTCTAACAAACAAA
AATTCCAGTCTNGATAATAATTCTATGGTAGACAAAAGAATTCTCAGCCTCTTGGGTTTC
CTGGAATTCTTTGCTTTATGCTCNTCCTCTTCCCTATGCACCTAAGGTAGTTTAGGAATA
AGATGTCACCCCTTGGCCATCCCCCTTTAAAACGTATCTTAATGTGAACATAAATTGTTC
CTTCATGATGCTTAAAAGCTTACCTATAATTTTCATTCTTAAAAAAACGCCCATTTTGGA
TCCGNGNATTTTTCCGAAATTCCTGGTTGAAAAAAACAACCCAAAATGAACCCCATCAAG
TGTGGGTTAACCTTT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_153831
ORF Size 3159 bp
Insert Size 4700
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_153831.2, NP_722560
RefSeq Size 4453
RefSeq ORF 3159
Locus ID 5747
Cytogenetics 8q24.3
Domains B41, pkinase, TyrKc, S_TKc, Focal_AT
Protein Families Protein Kinase, Druggable Genome
Protein Pathways ErbB signaling pathway, Chemokine signaling pathway, Axon guidance, VEGF signaling pathway, Focal adhesion, Leukocyte transendothelial migration, Regulation of actin cytoskeleton, Pathways in cancer, Small cell lung cancer
Gene Summary This gene encodes a cytoplasmic protein tyrosine kinase which is found concentrated in the focal adhesions that form between cells growing in the presence of extracellular matrix constituents. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Activation of this gene may be an important early step in cell growth and intracellular signal transduction pathways triggered in response to certain neural peptides or to cell interactions with the extracellular matrix. Several transcript variants encoding different isoforms have been found for this gene, but the full-length natures of only four of them have been determined. [provided by RefSeq, Oct 2015].
Transcript Variant: This variant (1) differs in the 5' UTR and coding sequence compared to variant 2. The resulting isoform (a) is shorter at the N-terminus compared to isoform b.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations