SERCA2(ATP2A2) (NM_170665) Human Untagged Clone

CAT#: SC101233

ATP2A2 (untagged)-Human ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 (ATP2A2), transcript variant 1

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name SERCA2(ATP2A2) (NM_170665) Human Untagged Clone
Symbol ATP2A2
Synonyms ATP2B; DAR; DD; SERCA2
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_170665, the custom clone sequence may differ by one or more nucleotides


ATGGAGAACGCGCACACCAAGACGGTGGAGGAGGTGCTGGGCCACTTCGGCGTCAACGAGAGTACGGGGC
TGAGCCTGGAACAGGTCAAGAAGCTTAAGGAGAGATGGGGCTCCAACGAGTTACCGGCTGAAGAAGGAAA
AACCTTGCTGGAACTTGTGATTGAGCAGTTTGAAGACTTGCTAGTTAGGATTTTATTACTGGCAGCATGT
ATATCTTTTGTTTTGGCTTGGTTTGAAGAAGGTGAAGAAACAATTACAGCCTTTGTAGAACCTTTTGTAA
TTTTACTCATATTAGTAGCCAATGCAATTGTGGGTGTATGGCAGGAAAGAAATGCTGAAAATGCCATCGA
AGCCCTTAAGGAATATGAGCCTGAAATGGGCAAAGTGTATCGACAGGACAGAAAGAGTGTGCAGCGGATT
AAAGCTAAAGACATAGTTCCTGGTGATATTGTAGAAATTGCTGTTGGTGACAAAGTTCCTGCTGATATAA
GGTTAACTTCCATCAAATCTACCACACTAAGAGTTGACCAGTCAATTCTCACAGGTGAATCTGTCTCTGT
CATCAAGCACACTGATCCCGTCCCTGACCCACGAGCTGTCAACCAAGATAAAAAGAACATGCTGTTTTCT
GGTACAAACATTGCTGCTGGGAAAGCTATGGGAGTGGTGGTAGCAACTGGAGTTAACACCGAAATTGGCA
AGATCCGGGATGAAATGGTGGCAACAGAACAGGAGAGAACACCCCTTCAGCAAAAACTAGATGAATTTGG
GGAACAGCTTTCCAAAGTCATCTCCCTTATTTGCATTGCAGTCTGGATCATAAATATTGGGCACTTCAAT
GACCCGGTTCATGGAGGGTCCTGGATCAGAGGTGCTATTTACTACTTTAAAATTGCAGTGGCCCTGGCTG
TAGCAGCCATTCCTGAAGGTCTGCCTGCAGTCATCACCACCTGCCTGGCTCTTGGAACTCGCAGAATGGC
AAAGAAAAATGCCATTGTTCGAAGCCTCCCGTCTGTGGAAACCCTTGGTTGTACTTCTGTTATCTGCTCA
GACAAGACTGGTACACTTACAACAAACCAGATGTCAGTCTGCAGGATGTTCATTCTGGACAGAGTGGAAG
GTGATACTTGTTCCCTTAATGAGTTTACCATAACTGGATCAACTTATGCACCTATTGGAGAAGTGCATAA
AGATGATAAACCAGTGAATTGTCACCAGTATGATGGTCTGGTAGAATTAGCAACAATTTGTGCTCTTTGT
AATGACTCTGCTTTGGATTACAATGAGGCAAAGGGTGTGTATGAAAAAGTTGGAGAAGCTACAGAGACTG
CTCTCACTTGCCTAGTAGAGAAGATGAATGTATTTGATACCGAATTGAAGGGTCTTTCTAAAATAGAACG
TGCAAATGCCTGCAACTCAGTCATTAAACAGCTGATGAAAAAGGAATTCACTCTAGAGTTTTCACGTGAC
AGAAAGTCAATGTCGGTTTACTGTACACCAAATAAACCAAGCAGGACATCAATGAGCAAGATGTTTGTGA
AGGGTGCTCCTGAAGGTGTCATTGACAGGTGCACCCACATTCGAGTTGGAAGTACTAAGGTTCCTATGAC
CTCTGGAGTCAAACAGAAGATCATGTCTGTCATTCGAGAGTGGGGTAGTGGCAGCGACACACTGCGATGC
CTGGCCCTGGCCACTCATGACAACCCACTGAGAAGAGAAGAAATGCACCTTGAGGACTCTGCCAACTTTA
TTAAATATGAGACCAATCTGACCTTCGTTGGCTGCGTGGGCATGCTGGATCCTCCGAGAATCGAGGTGGC
CTCCTCCGTGAAGCTGTGCCGGCAAGCAGGCATCCGGGTCATCATGATCACTGGGGACAACAAGGGCACT
GCTGTGGCCATCTGTCGCCGCATCGGCATCTTCGGGCAGGATGAGGACGTGACGTCAAAAGCTTTCACAG
GCCGGGAGTTTGATGAACTCAACCCCTCCGCCCAGCGAGACGCCTGCCTGAACGCCCGCTGTTTTGCTCG
AGTTGAACCCTCCCACAAGTCTAAAATCGTAGAATTTCTTCAGTCTTTTGATGAGATTACAGCTATGACT
GGCGATGGCGTGAACGATGCTCCTGCTCTGAAGAAAGCCGAGATTGGCATTGCTATGGGCTCTGGCACTG
CGGTGGCTAAAACCGCCTCTGAGATGGTCCTGGCGGATGACAACTTCTCCACCATTGTGGCTGCCGTTGA
GGAGGGGCGGGCAATCTACAACAACATGAAACAGTTCATCCGCTACCTCATCTCGTCCAACGTCGGGGAA
GTTGTCTGTATTTTCCTGACAGCAGCCCTTGGATTTCCCGAGGCTTTGATTCCTGTTCAGCTGCTCTGGG
TCAATCTGGTGACAGATGGCCTGCCTGCCACTGCACTGGGGTTCAACCCTCCTGATCTGGACATCATGAA
TAAACCTCCCCGGAACCCAAAGGAACCATTGATCAGCGGGTGGCTCTTTTTCCGTTACTTGGCTATTGGC
TGTTACGTCGGCGCTGCTACCGTGGGTGCTGCTGCATGGTGGTTCATTGCTGCTGACGGTGGTCCAAGAG
TGTCCTTCTACCAGCTGAGTCATTTCCTACAGTGTAAAGAGGACAACCCGGACTTTGAAGGCGTGGATTG
TGCAATCTTTGAATCCCCATACCCGATGACAATGGCGCTCTCTGTTCTAGTAACTATAGAAATGTGTAAC
GCCCTCAACAGCTTGTCCGAAAACCAGTCCTTGCTGAGGATGCCCCCCTGGGAGAACATCTGGCTCGTGG
GCTCCATCTGCCTGTCCATGTCACTCCACTTCCTGATCCTCTATGTCGAACCCTTGCCACTCATCTTCCA
GATCACACCGCTGAACGTGACCCAGTGGCTGATGGTGCTGAAAATCTCCTTGCCCGTGATTCTCATGGAT
GAGACGCTCAAGTTTGTGGCCCGCAACTACCTGGAACCTGGTAAAGAGTGTGTGCAGCCTGCCACCAAAT
CCTGCTCGTTCTCGGCATGCACCGATGGGATTTCCTGGCCGTTTGTGCTGCTCATAATGCCCCTGGTGAT
CTGGGTCTATAGCACAGACACTAACTTTAGCGATATGTTCTGGTCTTGA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_170665 unedited
AAACGTGTCAAAATTGTATACGACTCACTATAGGCGGCCGCGNAATTCGCACCAGGCGAG
GCGGAGGCGAGGAGGCCGCGGGGACGGGAGGCGAGGCCGGCCGGGCCCCCGAAGCCATGG
AGAACGCGCACACCAAGACGGTGGAGGAGGTGCTGGGCCACTTCGGCGTCAACGAGAGTA
CGGGGCTGAGCCTGGAACAGGTCAAGAAGCTTAAGGAGAGATGGGGCTCCAACGAGTTAC
CGGCTGAAGAAGGAAAAACCTTGCTGGAACTTGTGATTGAGCAGTTTGAAGACTTGCTAG
TTAGGATTTTATTACTGGCAGCATGTATATCTTTTGTTTTGGCTTGGTTTGAAGAAGGTG
AAGAAACAATTACAGCCTTTGTAGAACCTTTTGTAATTTTACTCATATTAGTAGCCAATG
CAATTGTGGGTGTATGGCAGGAAAGAAATGCTGAAAATGCCATCGAAGCCCTTAAGGAAT
ATGAGCCTGAAATGGGCAAAGTGTATCGACAGGACAGAAAGAGTGTGCAGCGGATTAAAG
CTAAAGACATAGTTCCTGGTGATATTGTAGAAATTGCTGTTGGTGACAAAGTTCCTGCTG
ATATAAGGTTAACTTCCATCAAATCTACCACACTAAGAGTTGACCAGTCAATTCTCACAG
GTGAATCTGTCTCTGTCATCAAGCACACTGATCCCGTCCCTGACCCACGAGCTGTCAACC
AAGATAAAAAGAACATGCTGTTTTCTGGTACAAACATTGCTGCTGGGAAAGCTATGGGAG
TGGTGGTAGCAACTGGAGTTAACNACCGAAATTGGCAGATCCGGGATGAAATGGTGGCCA
CAGAACAGAAGAGAACACCCCTTCAGCAAAACTAGATGAATTGGG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_170665 unedited
AAATTGGGGTAGAAAACGCCCTCTGATTAAATTAAAAACCCAAAAAAAAAAAAGAGCTGT
TTCAAAAAAAGTGTTGTTGAAAAAACAATGGTTGCAACAATAAAAAACATTAAACATTAA
AATAAATACCCTTAAAAACTCTGGGAGGGGACATAACCCCACTTTTTTGTTTCGGAAACA
ATGTTTTGTGCACACGCGAGTAAGGGTTACTCTTTGAAAAAACTGGTGAAAACAAAAAAA
AACAACACAATCCTAAAAAAAAACCCCCGCGGCGCGGGGAAAAGGGGGGGAGAGGTGGTG
TGNNTTNTNCNNCCCANAGCGTTATTTTTCTGAACATGTTCAATGGACACTATAATTATG
TGTGTAAAAAAGGAAAATCTTGCCCCGCTGGAATCAGAAAAAGCAAAACAAAATCTAGGG
TATGAAACCTCCATCACCAGCCAGTATGTTCATGTGAAAATTCAGCAGAAATAGACAGTT
GCTTTAAACAATAAAAAAATTAATTGATTAAGTTAAACATCTTATTTATGGAAAAACTGT
CTTCAAGACCAGAACATATTCTTAAAGTTAGTGGTTGTGCTATAGACCCCGATCACCAGG
GGCATTATGAGCAACACAAACGGTCCAGAAATTCAATCGGTGCATGCCGAGAACCAACAG
GGACTGGTTGCAGGCGTGACACACTCTTTACCAGTTCCAGTGAGGTGCGGGCCACAAACA
TGAGCTTCTCATCTTGAAAATCCAGGCAAGGAAATTTTCACTCCCTTAACCCTGGGACAC
ATAAAGCGGTGTGATCTGAAATAGAATGGCAGGGTTTGGAAAAACGTTTCAGAAGGGAAT
GACTGGCAAGTCTAATGGTTCCGTAGCCGAATGTTTTCCCGGGGGGATCCTACGCCGGCA
GGTGT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_170665
ORF Size 3129 bp
Insert Size 4100
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation A TrueClone.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_170665.2, NP_733765
RefSeq Size 4205
RefSeq ORF 3129
Locus ID 488
Cytogenetics 12q24.11
Domains E1-E2_ATPase, Cation_ATPase_N, Hydrolase, Cation_ATPase_C
Protein Families Transmembrane, Druggable Genome
Protein Pathways Calcium signaling pathway, Cardiac muscle contraction, Alzheimer's disease, Hypertrophic cardiomyopathy (HCM), Arrhythmogenic right ventricular cardiomyopathy (ARVC), Dilated cardiomyopathy
Gene Summary This gene encodes one of the SERCA Ca(2+)-ATPases, which are intracellular pumps located in the sarcoplasmic or endoplasmic reticula of muscle cells. This enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol into the sarcoplasmic reticulum lumen, and is involved in regulation of the contraction/relaxation cycle. Mutations in this gene cause Darier-White disease, also known as keratosis follicularis, an autosomal dominant skin disorder characterized by loss of adhesion between epidermal cells and abnormal keratinization. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2008].
Transcript Variant: This variant (b) represents the longer transcript and encodes the longer isoform (b, also known as SERCA2b, S2b or HK1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations