EIF4E3 (NM_173359) Human Untagged Clone

SKU
SC101093
EIF4E3 (untagged)-Human eukaryotic translation initiation factor 4E family member 3 (EIF4E3), transcript variant 2
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol EIF4E3
Synonyms eIF-4E3; eIF4E-3
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC101093 sequence for NM_173359 edited (data generated by NextGen Sequencing)
ATGAGAGGAGAGAGGCGACCACTTTGGGAAGAGGAGAGTAATGCAAAGGGTGGCGTATGG
AAGATGAAAGTCCCCAAGGACAGCACGTCCACAGTTTGGAAAGAGTTGCTGTTAGCAACC
ATCGGGGAACAGTTCACAGACTGTGCCGCAGCAGATGATGAAGTAATAGGAGTTAGTGTC
AGTGTTCGGGACCGAGAAGACGTCGTCCAAGTCTGGAATGTAAATGCCTCTTTAGTGGGT
GAAGCGACTGTTTTAGAAAAGATCTATGAACTTCTGCCCCACATAACTTTTAAAGCAGTA
TTTTATAAACCCCATGAAGAGCATCATGCTTTTGAAGGTGGACGTGGAAAACACTAA

Clone variation with respect to NM_173359.4
5' Read Nucleotide Sequence
>OriGene 5' read for NM_173359 unedited
TTTTGTACCACTTCTCACTATAGGCGGCCGCGAATTCGCACGAGCTCAGGGCTGTGGGGT
CACCTTCTCTTCCTCTCTTCTGCCACCCCAAGTCGTCTGTGTTGCGTGTCATGCAGTGGG
ACAGCACGTTGGTCCGGACCTCAAGCTACCCACGTTCTAGTCCCGCCTCTGTCATTTCCT
AGAGCTGTGGCCTCGGATCCCTCCCTGGTGCCACAGCAGCTGAGTGCGCATCAAATCTGA
AGAAAATCTACACAGTACAGACAGTACAGATATTTTGGAGTGTATACAATAATATCCCTC
CTGTGACTAGCCTGCCTTTGAGATGTAGTTATCATTTAATGAGAGGAGAGAGGCGACCAC
TTTGGGAAGAGGAGAGTAATGCAAAGGGTGGCGTATGGAAGATGAAAGTCCCCAAGGACA
GCACGTCCACAGTTTGGAAAGAGTTGCTGTTAGCAACCATCGGGGAACAGTTCACAGACT
GTGCCGCAGCAGATGATGAAGTAATAGGAGTTAGTGTCAGTGTTCGGGACCGAGAAGACG
TCGTCCAAGTCTGGAATGTAAATGCCTCTTTAGTGGGTGAAGCGACTGTTTTAGAAAAGA
TCTATGAACTTCTGCCCCACATAACTTTTAAAGCAGTATTTTATAAACCCCATGAAGAGC
ATCATGCTTTTGAAGGGTGGACGTGGAAAACACTAATTGCACTCTGTAAAGAATTCTTTG
TCCTTTGCTGATTGGTTTTGGAAACGGTCTTAACAGAGGGAGAGTGAAGAGAAGACTTGC
CCGAGCCGATGCTGGTCAATTANNAGTGGGTTTCTGTCCTTGCAGATGGGGCATTAGACT
CAAGTGGCAGTGGGTGGGGGATTTTTNNNNNNTNNTTTTT
Restriction Sites NotI-NotI
ACCN NM_173359
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_173359.3, NP_775495.1
RefSeq Size 2781 bp
RefSeq ORF 357 bp
Locus ID 317649
UniProt ID Q8N5X7
Cytogenetics 3p13
Summary EIF4E3 belongs to the EIF4E family of translational initiation factors that interact with the 5-prime cap structure of mRNA and recruit mRNA to the ribosome (Joshi et al., 2004 [PubMed 15153109]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (2) differs in its 5' UTR and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (b) has a shorter N-terminus, compared to isoform a. Variants 2-5 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:EIF4E3 (NM_173359) Human Untagged Clone
Your Rating
SKU Description Size Price
RC209694 EIF4E3 (Myc-DDK-tagged)-Human eukaryotic translation initiation factor 4E family member 3 (EIF4E3), transcript variant 2 10 ug
$150.00
RC209694L3 Lenti-ORF clone of EIF4E3 (Myc-DDK-tagged)-Human eukaryotic translation initiation factor 4E family member 3 (EIF4E3), transcript variant 2 10 ug
$450.00
RC209694L4 Lenti-ORF clone of EIF4E3 (mGFP-tagged)-Human eukaryotic translation initiation factor 4E family member 3 (EIF4E3), transcript variant 2 10 ug
$450.00
RG209694 EIF4E3 (tGFP-tagged) - Human eukaryotic translation initiation factor 4E family member 3 (EIF4E3), transcript variant 2 10 ug
$350.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.