Cathepsin L(CTSL) (NM_145918) Human Untagged Clone

CAT#: SC100267

CTSL1 (untagged)-Human cathepsin L1 (CTSL1), transcript variant 2

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Cathepsin L(CTSL) (NM_145918) Human Untagged Clone
Symbol CTSL
Synonyms CATL; CTSL1; MEP
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_145918, the custom clone sequence may differ by one or more nucleotides


ATGAATCCTACACTCATCCTTGCTGCCTTTTGCCTGGGAATTGCCTCAGCTACTCTAACATTTGATCACA
GTTTAGAGGCACAGTGGACCAAGTGGAAGGCGATGCACAACAGATTATACGGCATGAATGAAGAAGGATG
GAGGAGAGCAGTGTGGGAGAAGAACATGAAGATGATTGAACTGCACAATCAGGAATACAGGGAAGGGAAA
CACAGCTTCACAATGGCCATGAACGCCTTTGGAGACATGACCAGTGAAGAATTCAGGCAGGTGATGAATG
GCTTTCAAAACCGTAAGCCCAGGAAGGGGAAAGTGTTCCAGGAACCTCTGTTTTATGAGGCCCCCAGATC
TGTGGATTGGAGAGAGAAAGGCTACGTGACTCCTGTGAAGAATCAGGGTCAGTGTGGTTCTTGTTGGGCT
TTTAGTGCTACTGGTGCTCTTGAAGGACAGATGTTCCGGAAAACTGGGAGGCTTATCTCACTGAGTGAGC
AGAATCTGGTAGACTGCTCTGGGCCTCAAGGCAATGAAGGCTGCAATGGTGGCCTAATGGATTATGCTTT
CCAGTATGTTCAGGATAATGGAGGCCTGGACTCTGAGGAATCCTATCCATATGAGGCAACAGAAGAATCC
TGTAAGTACAATCCCAAGTATTCTGTTGCTAATGACACCGGCTTTGTGGACATCCCTAAGCAGGAGAAGG
CCCTGATGAAGGCAGTTGCAACTGTGGGGCCCATTTCTGTTGCTATTGATGCAGGTCATGAGTCCTTCCT
GTTCTATAAAGAAGGCATTTATTTTGAGCCAGACTGTAGCAGTGAAGACATGGATCATGGTGTGCTGGTG
GTTGGCTACGGATTTGAAAGCACAGAATCAGATAACAATAAATATTGGCTGGTGAAGAACAGCTGGGGTG
AAGAATGGGGCATGGGTGGCTACGTAAAGATGGCCAAAGACCGGAGAAACCATTGTGGAATTGCCTCAGC
AGCCAGCTACCCCACTGTGTGA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_145918 unedited
GTTCAAAATTTGTATACGACTCATATAGGGCGGCCGCGAATTCGCACGAGGCTCCGCAAC
CTTGAGCGGCATCCGTGGAGTGCGCCTGCGCAGCTACNACCGCAGCAGGAAAGCGCCGCC
GGCCAGGCCCAGCTGTGGCCGGACAGGGACTGGAAGAGAGGACGCGGTCGAGTTTTAAAA
CATGAATCCTACACTCATCCTTGCTGCCTTTTGCCTGGGAATTGCCTCAGCTACTCTAAC
ATTTGATCACAGTTTAGAGGCACAGTGGACCAAGTGGAAGGCGATGCACAACAGATTATA
CGGCATGAATGAAGAAGGATGGAGGAGAGCAGTGTGGGAGAAGAACATGAAGATGATTGA
ACTGCACAATCAGGAATACAGGGAAGGGAAACACAGCTTCACAATGGCCATGAACGCCTT
TGGAGACATGACCAGTGAAGAATTCAGGCAGGTGATGAATGGCTTTCAAAACCGTAAGCC
CAGGAAGGGGAAAGTGTTCCAGGAACCTCTGTTTTATGAGGCCCCCAGATCTGTGGATTG
GAGAGAGAAAGGCTACGTGACTCCTGTGAAGAATCAGGGTCAGTGTGGTTCTTGTTGGGC
TTTTAGTGCTACTGGTGCTCTTGAAGGACAGATGTTCCGGANAACTGGGAGGCTTATCTC
ACTGAGTGAGCAGAATCTGGTAGACTGCTCTGGGCCTCAAGGCAATGAAGGCTGCAATGG
TGGCCTAATGGATTATGCTTTCCAGTATGTTCAGGATAATGGAGGCCTGGACTCTGAGGA
ATCCTATCCATATGAGGGCACAGAAGAATCCCTGTAGTACATCCCCCAGTATTCTGTTGC
TAATGACACCGGCTTTTGTGGACATNCCTTTAGCAGGAGAAGCCCTGATGAAGGCAGTGC
ACCTGTGGGCCCCATTTCTGGTGTATGGATGCAGNCACTGG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_145918 unedited
GAACCGCGGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTACATTTGAAAATTAAATTTTATTTAAACAGGGAAAAATTTATACATCC
TTTTAAAAACGAAAATGCAAAGTCAGTAAGGGAATCAATAATATAAACCTATTTATAGCA
GTAATTAAAATAGAGGGAACATTTACCAGGGGGAAAATATCACAGAATTCAAATCACACT
CGGATCTTCAATGATTCGAGGGGGTATCCGACACAGGGGGGGCTGGTAAACTGAAAATGA
ATTCCTCCCATGCATGCGCCATCCCCAGTCAAGTCCTTCCTTATCACCGTCCACCAGCTC
ACACAGTGGGGTAACTGGCTGCTGAGGCAATTCCACAATGGTTTCTCCGGTCTTTGGCCA
TTTTTACGTAGCCACCCATGCCCCATTCTTCACCCCAGCTGTTTTTCACCAGCCAATATT
TATTGGTATCTGATTCTGGGCTTTCAAATCCGTAGCCAACCACCAGCACACCATGATCCA
TGTCTTCACTGCTACAGTCTGGCTCAAAATAAATGCCTTCTTTATAGAACAGGAAGGACT
CATGACCTGCATCAATAGCAACAGAAATGGGCCCCACAGTTGCAACTGCCTTCATCAGGG
GCCTTCTCTGCTTAGGGATGTCCACAAAGCCGGTGTCATTAGCAACAGATACTTGGGATN
GACCTACAGGATTCCCCTGTTGCCTCATATGGATAGGATTNCCTCAAAGTCAGGGCTNCA
TTATCCTGAAACTACTGGAAAGCATATTCCTTTAGGCCACATTGCAGGCTTTAATTGCCT
TGAGGGCCAAAAAAGTCTACAAATTTTGCNACCTCAGGAAAAAGGCTCCCAGTTTTTCGG
AACATTGGCTTTAG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_145918
ORF Size 1002 bp
Insert Size 1500
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_145918.1, NP_666023
RefSeq Size 1487
RefSeq ORF 1002
Locus ID 1514
Cytogenetics 9q21.33
Domains Pept_C1
Protein Families Protease, Druggable Genome
Protein Pathways Lysosome, Antigen processing and presentation
Gene Summary The protein encoded by this gene is a lysosomal cysteine proteinase that plays a major role in intracellular protein catabolism. Its substrates include collagen and elastin, as well as alpha-1 protease inhibitor, a major controlling element of neutrophil elastase activity. The encoded protein has been implicated in several pathologic processes, including myofibril necrosis in myopathies and in myocardial ischemia, and in the renal tubular response to proteinuria. This protein, which is a member of the peptidase C1 family, is a dimer composed of disulfide-linked heavy and light chains, both produced from a single protein precursor. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2012].
Transcript Variant: This variant (2) has an alternate splice site in the 5' UTR, compared to variant 1. Variants 1-4 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations