ADCY4 (NM_139247) Human Untagged Clone

CAT#: SC100206

ADCY4 (untagged)-Human adenylate cyclase 4 (ADCY4), transcript variant 2

USD 2,060.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name ADCY4 (NM_139247) Human Untagged Clone
Symbol ADCY4
Synonyms AC4; AC4
Vector pCMV6-XL6
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_139247 edited
GCCCTTGCGGGTGAGAAAAGCTCAGGTGGGGCCCGCCGGGCCGAAGGAGGTAACCCGGCG
CCCGGCCCTAGCCAGCCCCGGGGCTCGGGGCTGGGGAGATCATGGCCCGCCTCTTCAGCC
CCCGGCCGCCCCCCAGCGAAGACCTCTTCTACGAGACCTACTACAGCCTGAGCCAGCAGT
ACCCGCTGCTGCTGCTGCTGCTGGGGATCGTGCTCTGTGCGCTCGCGGCGCTGCTCGCAG
TGGCCTGGGCCAGCGGCAGGGAGCTGACCTCAGACCCGAGCTTCCTGACCACTGTGCTGT
GCGCGCTGGGCGGCTTCTCGCTGCTGCTGGGCCTCGCTTCCCGGGAGCAGCGACTGCAGC
GCTGGACGCGTCCCCTGTCCGGCTTGGTATGGGTCGCGCTGCTAGCGCTAGGCCACGCCT
TCCTGTTCACCGGGGGCGTGGTGAGCGCCTGGGACCAGGTGTCCTATTTTCTCTTCGTCA
TCTTCACGGCGTATGCCATGCTGCCCTTGGGCATGCGGGACGCCGCCGTCGCGGGCCTCG
CCTCCTCACTCTCGCATCTGCTGGTCCTCGGGCTGTATCTTGGGCCACAGCCGGACTCAC
GGCCTGCACTGCTGCCGCAGTTGGCAGCAAACGCAGTGCTGTTCCTGTGCGGGAACGTGG
CAGGAGTGTACCACAAGGCGCTGATGGAGCGCGCCCTGCGGGCCACGTTCCGGGAGGCAC
TCAGCTCCCTGCACTCACGCCGGCGGCTGGACACCGAGAAGAAGCACCAGGAACACCTTC
TCTTGTCCATCCTTCCTGCCTACCTGGCCCGAGAGATGAAGGCAGAGATCATGGCACGGC
TGCAGGCAGGACAGGGGTCACGGCCAGAGAGCACTAACAATTTCCACAGCCTCTATGTCA
AGAGGCACCAGGGAGTCAGCGTGCTGTATGCTGACATCGTGGGCTTCACGCGGCTGGCCA
GCGAGTGTTCCCCTAAGGAGCTGGTGCTCATGCTCAATGAGCTCTTTGGCAAGTTCGACC
AGATTGCCAAGGAGCATGAATGCATGCGGATCAAGATCCTGGGGGACTGTTACTACTGTG
TCTCTGGGCTGCCACTCTCACTGCCAGACCATGCCATCAACTGCGTGCGCATGGGCCTGG
ACATGTGCCGGGCCATCAGGAAACTGCGGGCAGCCACTGGCGTGGACATCAACATGCGTG
TGGGCGTGCACTCAGGCAGCGTACTGTGTGGAGTCATCGGGCTGCAGAAGTGGCAGTACG
ACGTTTGGTCACATGATGTCACACTGGCTAACCACATGGAGGCAGGCGGTGTACCAGGGC
GAGTGCACATCACAGGGGCTACCCTGGCCCTGCTGGCAGGGGCTTATGCTGTGGAGGACG
CAGGCATGGAGCATCGGGACCCCTACCTTCGGGAGCTAGGGGAGCCTACCTATCTGGTCA
TCGATCCACGGGCAGAGGAGGAGGATGAGAAGGGCACTGCAGGAGGCTTGCTGTCCTCGC
TTGAGGGCCTCAAGATGCGTCCATCACTGCTGATGACCCGTTACCTGGAGTCCTGGGGCG
CAGCCAAGCCTTTTGCCCACCTGAGCCACGGAGACAGCCCTGTGTCCACCTCCACCCCTC
TCCCGGAGAAGACCCTGGCTTCCTTCAGCACCCAGTGGAGCCTGGATCGGAGCCGTACCC
CCCGGGGACTAGATGATGAACTGGACACCGGGGATGCCAAGTTCTTCCAGGTCATTGAGC
AGCTCAACTCGCAGAAACAGTGGAAGCAGTCGAAGGACTTCAACCCACTGACACTGTACT
TCAGAGAGAAGGAGATGGAGAAAGAGTACCGACTCTCTGCAATCCCCGCCTTCAAATACT
ATGAAGCCTGCACCTTCCTGGTTTTTCTCTCCAACTTCATCATCCAGATGCTAGTGACAA
ACAGGCCCCCAGCTCTGGCCATCACGTATAGCATCACCTTCCTCCTCTTCCTCCTCATCC
TTTTTGTCTGCTTCTCAGAGGACCTGATGAGGTGTGTCCTGAAAGGCCCCAAGATGCTGC
ACTGGCTGCCTGCACTGTCTGGCCTGGTGGCCACACGACCAGGACTGAGAATAGCCTTGG
GCACCGCCACCATCCTCCTTGTCTTTGCCATGGCCATTACCAGCCTGTTCTTCTTCCCAA
CATCATCAGACTGCCCTTTCCAAGCTCCCAATGTGTCCTCCATGATTTCCAACCTCTCCT
GGGAGCTCCCTGGGTCTCTGCCTCTCATCAGTGTCCCATACTCCATGCACTGCTGCACGC
TGGGCTTCCTCTCCTGCTCCCTCTTTCTGCACATGAGCTTCGAGCTGAAGCTGCTGCTGC
TCCTGCTGTGGCTGGCGGCATCCTGCTCCCTCTTCCTGCACTCCCATGCCTGGCTGTCGG
AATGCCTCATCGTCCGCCTCTATCTGGGCCCCTTGGACTCCAGGCCCGGAGTGCTGAAGG
AGCCCAAACTGATGGGTGCTATCTCCTTCTTCATCTTCTTCTTCACCCTCCTTGTCCTGG
CTCGCCAGAATGAGTACTACTGCCGCCTGGACTTCCTGTGGAAGAAGAAGCTGAGGCAGG
AGAGGGAGGAGACAGAGACGATGGAGAACCTGACTCGGCTGCTCTTGGAGAACGTGCTCC
CTGCACACGTGGCCCCCCAGTTCATTGGCCAGAACCGGCGCAACGAGGATCTCTACCACC
AGTCCTATGAATGCGTTTGTGTCCTCTTCGCCTCAGTCCCAGACTTCAAGGAGTTCTACT
CTGAATCCAACATCAATCATGAGGGCCTAGAGTGTCTGAGGCTGCTCAATGAGATAATTG
CTGATTTTGATGAGCTGCTCTCCAAGCCCAAGTTCAGTGGGGTGGAGAAGATCAAGACCA
TCGGCAGCACCTACATGGCAGCCACAGGCTTAAATGCCACCTCTGGACAGGATGCACAAC
AGGATGCTGAACGGAGCTGCAGCCACCTTGGCACTATGGTGGAATTTGCCGTGGCCCTGG
GGTCTAAGCTGGACGTCATCAACAAGCATTCATTCAACAACTTCCGCCTGCGAGTGGGGT
TGAACCATGGACCCGTAGTAGCTGGAGTTATTGGGGCCCAGAAGCCGCAATATGACATTT
GGGGCAACACAGTGAACGTGGCCAGCCGCATGGAGAGTACAGGAGTCCTTGGCAAAATCC
AAGTGACTGAGGAGACAGCATGGGCCCTACAGTCCCTGGGCTACACCTGCTACAGCCGGG
GTGTCATCAAGGTGAAAGGCAAAGGGCAGCTCTGCACCTACTTCCTGAACACAGACTTGA
CACGAACTGGACCTCCTTCAGCTACCCTAGGCTGAGATTGCACTCGCCTTCTAAGAACC
Tag Tag Free
ACCN NM_139247
ORF Size 3234 bp
Insert Size 3360
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_139247.2.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_139247.2, NP_640340
RefSeq Size 3320
Locus ID 196883
Cytogenetics 14q12
Domains guanylate_cyc
Protein Families Transmembrane, Druggable Genome
Protein Pathways Purine metabolism, Calcium signaling pathway, Chemokine signaling pathway, Oocyte meiosis, Vascular smooth muscle contraction, Gap junction, Taste transduction, GnRH signaling pathway, Progesterone-mediated oocyte maturation, Melanogenesis, Dilated cardiomyopathy
Gene Summary This gene encodes a member of the family of adenylate cyclases, which are membrane-associated enzymes that catalyze the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). Mouse studies show that adenylate cyclase 4, along with adenylate cyclases 2 and 3, is expressed in olfactory cilia, suggesting that several different adenylate cyclases may couple to olfactory receptors and that there may be multiple receptor-mediated mechanisms for the generation of cAMP signals. Alternative splicing results in transcript variants. [provided by RefSeq, Nov 2010].
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations